Incidental Mutation 'R0350:Dhcr7'
ID 29653
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 038557-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0350 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 143391507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000146636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000144034] [ENSMUST00000143338] [ENSMUST00000207143] [ENSMUST00000145471]
AlphaFold O88455
Predicted Effect probably damaging
Transcript: ENSMUST00000073878
AA Change: D32G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: D32G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124340
AA Change: D32G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: D32G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125564
AA Change: D32G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect probably damaging
Transcript: ENSMUST00000141916
AA Change: D32G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: D32G

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144034
AA Change: D32G
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454
AA Change: D32G

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143338
AA Change: D32G

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: D32G

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207143
AA Change: D35G

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 10,037,600 (GRCm39) Y66N probably damaging Het
Apol6 C T 15: 76,935,147 (GRCm39) Q139* probably null Het
Armh1 C A 4: 117,072,753 (GRCm39) E244* probably null Het
Cd1d1 A T 3: 86,904,880 (GRCm39) H219Q probably benign Het
Cdca2 A G 14: 67,950,568 (GRCm39) L121P probably benign Het
Cdin1 T C 2: 115,607,411 (GRCm39) Y255H possibly damaging Het
Cog4 T A 8: 111,580,328 (GRCm39) L133I possibly damaging Het
Csf1 T C 3: 107,655,922 (GRCm39) M370V probably benign Het
Ddi2 G A 4: 141,412,834 (GRCm39) T26M probably benign Het
Efcab3 T C 11: 104,581,706 (GRCm39) V16A probably benign Het
Exd1 T C 2: 119,354,047 (GRCm39) N337S possibly damaging Het
Flii T C 11: 60,612,683 (GRCm39) D227G probably damaging Het
Hsf1 A G 15: 76,384,679 (GRCm39) T485A probably benign Het
Igfn1 G A 1: 135,884,505 (GRCm39) R2614* probably null Het
Iqch T C 9: 63,408,158 (GRCm39) T630A probably benign Het
Itgal T A 7: 126,921,253 (GRCm39) D770E probably damaging Het
Mroh1 T A 15: 76,316,449 (GRCm39) V759E probably damaging Het
Mrps17 A G 5: 129,795,209 (GRCm39) probably benign Het
Mtpap A G 18: 4,396,195 (GRCm39) S496G possibly damaging Het
Nkd1 T A 8: 89,311,844 (GRCm39) Y39* probably null Het
Nmd3 A G 3: 69,650,907 (GRCm39) Y359C probably damaging Het
Nr1h3 G A 2: 91,022,170 (GRCm39) L153F possibly damaging Het
Nuf2 T A 1: 169,341,112 (GRCm39) probably null Het
Or4b1b T C 2: 90,112,926 (GRCm39) probably null Het
Or4c113 T A 2: 88,885,700 (GRCm39) K23N probably benign Het
Or8b12i A T 9: 20,082,032 (GRCm39) Y278* probably null Het
Pnn T C 12: 59,113,903 (GRCm39) probably null Het
Ppm1j A G 3: 104,690,687 (GRCm39) D230G probably benign Het
Ppp1r15a A T 7: 45,172,442 (GRCm39) L650Q probably damaging Het
Prss37 T C 6: 40,491,893 (GRCm39) E229G probably damaging Het
Rbm19 T C 5: 120,266,372 (GRCm39) V465A possibly damaging Het
Rubcnl G T 14: 75,278,331 (GRCm39) V372F probably damaging Het
Sema6a G T 18: 47,403,785 (GRCm39) D595E probably benign Het
Slc35c1 A G 2: 92,289,377 (GRCm39) F43S probably damaging Het
Slc39a5 C T 10: 128,232,619 (GRCm39) probably null Het
Slco4c1 A G 1: 96,756,574 (GRCm39) F583L probably benign Het
Sox9 A G 11: 112,675,702 (GRCm39) Y297C probably damaging Het
Taf1b A G 12: 24,564,884 (GRCm39) D167G possibly damaging Het
Trpm6 T C 19: 18,861,321 (GRCm39) probably null Het
Uba6 A C 5: 86,292,237 (GRCm39) V402G possibly damaging Het
Usp43 T C 11: 67,767,324 (GRCm39) Y682C probably damaging Het
Vmn1r195 A G 13: 22,463,403 (GRCm39) D291G probably damaging Het
Xpr1 A T 1: 155,206,214 (GRCm39) F156Y probably damaging Het
Yju2b C T 8: 84,987,277 (GRCm39) E99K probably damaging Het
Zfp318 T A 17: 46,724,124 (GRCm39) H2042Q probably benign Het
Zfp937 T A 2: 150,081,222 (GRCm39) D417E possibly damaging Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4944:Dhcr7 UTSW 7 143,391,528 (GRCm39) missense probably damaging 0.96
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGTCATCTTGAGCCCTGCCAC -3'
(R):5'- TGGTGTCTTGGCCCAAATGTCTGC -3'

Sequencing Primer
(F):5'- GGAAGAGTGTCTTAAGCATCCTACC -3'
(R):5'- ATGTCTGCCAGACTAGCATGG -3'
Posted On 2013-04-24