Incidental Mutation 'R0350:Cog4'
ID29657
Institutional Source Beutler Lab
Gene Symbol Cog4
Ensembl Gene ENSMUSG00000031753
Gene Namecomponent of oligomeric golgi complex 4
SynonymsD8Ertd515e
MMRRC Submission 038557-MU
Accession Numbers

Genbank: NM_133973; MGI: 2142808  

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location110846600-110882227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110853696 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 133 (L133I)
Ref Sequence ENSEMBL: ENSMUSP00000133458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034203] [ENSMUST00000165867] [ENSMUST00000172668] [ENSMUST00000172897] [ENSMUST00000174165] [ENSMUST00000174398] [ENSMUST00000174679] [ENSMUST00000174723]
Predicted Effect probably benign
Transcript: ENSMUST00000034203
AA Change: L187I

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034203
Gene: ENSMUSG00000031753
AA Change: L187I

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 178 1e-53 BLAST
Cog4 188 498 1.81e-140 SMART
Pfam:RINT1_TIP1 536 773 3.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165867
AA Change: L114I

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128518
Gene: ENSMUSG00000031753
AA Change: L114I

DomainStartEndE-ValueType
Blast:Cog4 8 105 6e-54 BLAST
Cog4 115 425 1.81e-140 SMART
PDB:3HR0|B 452 712 1e-174 PDB
Blast:DIL 621 702 6e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172668
SMART Domains Protein: ENSMUSP00000134252
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Blast:Cog4 81 117 1e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172897
SMART Domains Protein: ENSMUSP00000133583
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174165
SMART Domains Protein: ENSMUSP00000134306
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174398
AA Change: L186I

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133297
Gene: ENSMUSG00000031753
AA Change: L186I

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
coiled coil region 33 76 N/A INTRINSIC
Blast:Cog4 80 177 9e-54 BLAST
Cog4 187 497 1.81e-140 SMART
PDB:3HR0|B 524 763 1e-153 PDB
Blast:DIL 672 753 7e-38 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000174679
AA Change: L133I

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133458
Gene: ENSMUSG00000031753
AA Change: L133I

DomainStartEndE-ValueType
Blast:Cog4 27 174 5e-60 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174702
Predicted Effect probably benign
Transcript: ENSMUST00000174723
SMART Domains Protein: ENSMUSP00000133471
Gene: ENSMUSG00000031753

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
coiled coil region 34 77 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174800
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Cog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Cog4 APN 8 110866085 missense probably benign 0.44
IGL01631:Cog4 APN 8 110881840 missense probably damaging 1.00
IGL01756:Cog4 APN 8 110853759 nonsense probably null
IGL02850:Cog4 APN 8 110866589 missense possibly damaging 0.46
IGL02932:Cog4 APN 8 110852433 missense probably benign 0.16
IGL03232:Cog4 APN 8 110880682 splice site probably null
Deminimis UTSW 8 110881480 missense probably damaging 0.98
PIT4362001:Cog4 UTSW 8 110866672 missense probably damaging 1.00
R1368:Cog4 UTSW 8 110858525 unclassified probably benign
R1531:Cog4 UTSW 8 110879721 missense probably benign 0.30
R2110:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2112:Cog4 UTSW 8 110858582 missense possibly damaging 0.62
R2867:Cog4 UTSW 8 110866659 intron probably benign
R4239:Cog4 UTSW 8 110858612 missense probably damaging 0.98
R4867:Cog4 UTSW 8 110866610 missense probably damaging 1.00
R4967:Cog4 UTSW 8 110852283 splice site probably null
R5124:Cog4 UTSW 8 110847193 missense probably damaging 1.00
R5655:Cog4 UTSW 8 110863307 missense probably damaging 1.00
R6024:Cog4 UTSW 8 110881480 missense probably damaging 0.98
R6347:Cog4 UTSW 8 110880643 missense probably damaging 1.00
R6475:Cog4 UTSW 8 110880894 missense possibly damaging 0.74
R6526:Cog4 UTSW 8 110881786 missense probably damaging 1.00
R6542:Cog4 UTSW 8 110851362 missense probably damaging 1.00
R6545:Cog4 UTSW 8 110880945 missense probably damaging 1.00
R7248:Cog4 UTSW 8 110882202 missense unknown
R7292:Cog4 UTSW 8 110881828 missense probably damaging 1.00
R7356:Cog4 UTSW 8 110849866 critical splice acceptor site probably null
R7440:Cog4 UTSW 8 110879706 missense probably benign 0.06
R7751:Cog4 UTSW 8 110880968 missense probably damaging 1.00
R8170:Cog4 UTSW 8 110866031 missense probably damaging 0.98
R8181:Cog4 UTSW 8 110852085 splice site probably null
Z1177:Cog4 UTSW 8 110879015 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACACAGAGATTTGACTTTTAGGCACC -3'
(R):5'- CCGAGAACTTGCTCAGGCCATC -3'

Sequencing Primer
(F):5'- GAACACAGGCACAGTTCTTCTTAC -3'
(R):5'- TCCTCATGTAAACCCAGCAGTG -3'
Posted On2013-04-24