Incidental Mutation 'R0350:Iqch'
ID29659
Institutional Source Beutler Lab
Gene Symbol Iqch
Ensembl Gene ENSMUSG00000037801
Gene NameIQ motif containing H
Synonyms4921504K03Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location63421455-63602493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63500876 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 630 (T630A)
Ref Sequence ENSEMBL: ENSMUSP00000131828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042322] [ENSMUST00000080527] [ENSMUST00000163624] [ENSMUST00000163982] [ENSMUST00000171243]
Predicted Effect probably benign
Transcript: ENSMUST00000042322
AA Change: T669A

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047953
Gene: ENSMUSG00000037801
AA Change: T669A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080527
AA Change: T669A

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079370
Gene: ENSMUSG00000037801
AA Change: T669A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126238
Predicted Effect probably benign
Transcript: ENSMUST00000163624
AA Change: T669A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128482
Gene: ENSMUSG00000037801
AA Change: T669A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163982
AA Change: T669A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126546
Gene: ENSMUSG00000037801
AA Change: T669A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171243
AA Change: T630A

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131828
Gene: ENSMUSG00000037801
AA Change: T630A

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
IQ 366 388 2.79e0 SMART
low complexity region 440 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Iqch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Iqch APN 9 63480654 missense probably damaging 0.96
IGL01472:Iqch APN 9 63547934 missense probably benign 0.02
IGL01553:Iqch APN 9 63500917 missense probably benign 0.00
IGL01611:Iqch APN 9 63496237 critical splice acceptor site probably null
IGL02608:Iqch APN 9 63421828 unclassified probably benign
IGL03060:Iqch APN 9 63524914 missense probably damaging 1.00
IGL03154:Iqch APN 9 63454682 missense probably damaging 0.97
I2288:Iqch UTSW 9 63500890 missense probably benign 0.01
R0002:Iqch UTSW 9 63594743 splice site probably benign
R0532:Iqch UTSW 9 63508232 splice site probably benign
R0629:Iqch UTSW 9 63425382 missense probably benign 0.22
R0710:Iqch UTSW 9 63525136 missense probably benign
R0766:Iqch UTSW 9 63482683 missense probably benign 0.02
R1797:Iqch UTSW 9 63588377 missense possibly damaging 0.58
R1856:Iqch UTSW 9 63534337 splice site probably null
R1954:Iqch UTSW 9 63548016 missense probably benign 0.00
R1955:Iqch UTSW 9 63548016 missense probably benign 0.00
R2184:Iqch UTSW 9 63525069 missense probably damaging 0.99
R2264:Iqch UTSW 9 63512299 missense probably benign 0.27
R4614:Iqch UTSW 9 63482581 missense probably benign
R4643:Iqch UTSW 9 63594802 missense probably benign 0.00
R4654:Iqch UTSW 9 63524913 missense probably damaging 0.99
R4665:Iqch UTSW 9 63445571 missense probably damaging 1.00
R5027:Iqch UTSW 9 63525012 missense possibly damaging 0.87
R5042:Iqch UTSW 9 63496234 missense possibly damaging 0.48
R5551:Iqch UTSW 9 63496253 intron probably null
R5829:Iqch UTSW 9 63425357 critical splice donor site probably null
R5878:Iqch UTSW 9 63547990 missense probably damaging 0.99
R6816:Iqch UTSW 9 63480759 missense probably benign 0.02
R6930:Iqch UTSW 9 63480574 missense possibly damaging 0.79
R7000:Iqch UTSW 9 63454610 missense probably benign
R7026:Iqch UTSW 9 63525139 nonsense probably null
R7066:Iqch UTSW 9 63524745 missense probably benign 0.24
R7111:Iqch UTSW 9 63512317 missense possibly damaging 0.79
R7129:Iqch UTSW 9 63421909 missense probably benign 0.09
R7177:Iqch UTSW 9 63421835 makesense probably null
R7252:Iqch UTSW 9 63512236 critical splice donor site probably null
R7485:Iqch UTSW 9 63508317 missense possibly damaging 0.47
R7541:Iqch UTSW 9 63445521 missense possibly damaging 0.95
X0066:Iqch UTSW 9 63429058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGAGGATAAGGTCCTGTCATGC -3'
(R):5'- AGGATAGGTCATAACCCAGCCTGC -3'

Sequencing Primer
(F):5'- TGGGCTCCGTTCACAGAATAG -3'
(R):5'- CTGATGTACAGTCCCAAGGC -3'
Posted On2013-04-24