Incidental Mutation 'R0350:Slc39a5'
ID29660
Institutional Source Beutler Lab
Gene Symbol Slc39a5
Ensembl Gene ENSMUSG00000039878
Gene Namesolute carrier family 39 (metal ion transporter), member 5
SynonymsZip5, 2010205A06Rik, 1810013D05Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128395931-128401229 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 128396750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642] [ENSMUST00000026439] [ENSMUST00000042666] [ENSMUST00000042666] [ENSMUST00000042666] [ENSMUST00000164199] [ENSMUST00000166608] [ENSMUST00000167859] [ENSMUST00000167859] [ENSMUST00000167859] [ENSMUST00000218858] [ENSMUST00000219131]
Predicted Effect probably benign
Transcript: ENSMUST00000014642
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026439
SMART Domains Protein: ENSMUSP00000026439
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000042666
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000042666
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000042666
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164199
SMART Domains Protein: ENSMUSP00000128634
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 23 105 1.7e-9 PFAM
low complexity region 131 148 N/A INTRINSIC
low complexity region 161 178 N/A INTRINSIC
low complexity region 185 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166608
SMART Domains Protein: ENSMUSP00000131171
Gene: ENSMUSG00000025374

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 39 120 4.2e-9 PFAM
low complexity region 147 164 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 201 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167456
Predicted Effect probably null
Transcript: ENSMUST00000167859
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167859
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167859
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218858
Predicted Effect probably benign
Transcript: ENSMUST00000219131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219222
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ZIP family of zinc transporters that transport zinc into cells from outside, and play a crucial role in controlling intracellular zinc levels. Zinc is an essential cofactor for many enzymes and proteins involved in gene transcription, growth, development and differentiation. Mutations in this gene have been associated with autosomal dominant high myopia (MYP24). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered zinc homeostasis and increased susceptibility to zinc-induced pancretitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Slc39a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Slc39a5 APN 10 128399330 missense probably benign 0.00
IGL02666:Slc39a5 APN 10 128398455 missense probably damaging 1.00
R0305:Slc39a5 UTSW 10 128398396 unclassified probably benign
R0437:Slc39a5 UTSW 10 128399847 missense possibly damaging 0.94
R1401:Slc39a5 UTSW 10 128397741 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398410 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398411 missense probably damaging 1.00
R2286:Slc39a5 UTSW 10 128396060 missense probably benign 0.00
R4041:Slc39a5 UTSW 10 128396468 missense possibly damaging 0.95
R4649:Slc39a5 UTSW 10 128397267 missense probably benign 0.00
R4776:Slc39a5 UTSW 10 128397049 missense probably damaging 0.98
R4890:Slc39a5 UTSW 10 128398447 missense probably benign 0.13
R5911:Slc39a5 UTSW 10 128399943 missense probably damaging 1.00
R6703:Slc39a5 UTSW 10 128397782 missense probably damaging 1.00
R8428:Slc39a5 UTSW 10 128397015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGCAGCTTCCGAAAGGATAAC -3'
(R):5'- AGTATCGCATGGATGGTCCTCCTG -3'

Sequencing Primer
(F):5'- TTCCGAAAGGATAACCCTTCCTG -3'
(R):5'- TAGGTCTGAGGCTACAGACAC -3'
Posted On2013-04-24