Incidental Mutation 'R0350:Usp43'
ID29662
Institutional Source Beutler Lab
Gene Symbol Usp43
Ensembl Gene ENSMUSG00000020905
Gene Nameubiquitin specific peptidase 43
Synonyms
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67854523-67922153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67876498 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 682 (Y682C)
Ref Sequence ENSEMBL: ENSMUSP00000021288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021288] [ENSMUST00000108677]
Predicted Effect probably damaging
Transcript: ENSMUST00000021288
AA Change: Y682C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905
AA Change: Y682C

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108677
AA Change: Y677C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905
AA Change: Y677C

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129961
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Usp43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Usp43 APN 11 67891419 missense probably benign 0.08
IGL01536:Usp43 APN 11 67855938 missense probably benign 0.01
IGL01754:Usp43 APN 11 67856181 missense probably benign 0.06
IGL02057:Usp43 APN 11 67856287 missense probably benign 0.02
IGL02638:Usp43 APN 11 67855755 missense probably benign 0.06
IGL03105:Usp43 APN 11 67879976 missense possibly damaging 0.82
IGL03155:Usp43 APN 11 67876489 missense probably damaging 1.00
IGL03380:Usp43 APN 11 67875316 missense possibly damaging 0.67
R0207:Usp43 UTSW 11 67876499 missense probably damaging 1.00
R0308:Usp43 UTSW 11 67880140 missense probably damaging 1.00
R0479:Usp43 UTSW 11 67897274 missense possibly damaging 0.96
R1451:Usp43 UTSW 11 67856181 missense probably benign 0.01
R1686:Usp43 UTSW 11 67887767 missense probably damaging 0.99
R1750:Usp43 UTSW 11 67879953 missense probably damaging 1.00
R1956:Usp43 UTSW 11 67904333 missense probably damaging 1.00
R2107:Usp43 UTSW 11 67855740 frame shift probably null
R2108:Usp43 UTSW 11 67855740 frame shift probably null
R2112:Usp43 UTSW 11 67921710 missense probably damaging 1.00
R2162:Usp43 UTSW 11 67879969 missense probably damaging 1.00
R2336:Usp43 UTSW 11 67891432 nonsense probably null
R4031:Usp43 UTSW 11 67913833 missense probably damaging 1.00
R4355:Usp43 UTSW 11 67891464 missense probably benign 0.01
R4410:Usp43 UTSW 11 67855890 missense probably benign 0.00
R4479:Usp43 UTSW 11 67856407 missense possibly damaging 0.96
R4569:Usp43 UTSW 11 67875352 nonsense probably null
R4569:Usp43 UTSW 11 67898962 missense probably damaging 1.00
R4737:Usp43 UTSW 11 67855505 missense probably damaging 1.00
R5395:Usp43 UTSW 11 67897358 critical splice acceptor site probably null
R5466:Usp43 UTSW 11 67913883 missense probably damaging 0.99
R5686:Usp43 UTSW 11 67921916 unclassified probably benign
R6106:Usp43 UTSW 11 67879907 missense probably benign 0.00
R7205:Usp43 UTSW 11 67883284 missense probably null 1.00
R7360:Usp43 UTSW 11 67876329 intron probably null
R7426:Usp43 UTSW 11 67893016 missense possibly damaging 0.60
R7755:Usp43 UTSW 11 67891468 missense possibly damaging 0.94
R8054:Usp43 UTSW 11 67891458 missense probably damaging 0.96
Z1088:Usp43 UTSW 11 67856040 missense probably benign 0.39
Z1176:Usp43 UTSW 11 67921841 missense unknown
Z1177:Usp43 UTSW 11 67855808 missense possibly damaging 0.56
Z1177:Usp43 UTSW 11 67922032 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCCTTCTATAAATGGACGGCAGG -3'
(R):5'- TCTCAGTATAATCGGGTGAGCGGTG -3'

Sequencing Primer
(F):5'- gtgcggaggtcaaagaaaac -3'
(R):5'- TTCCAGTGAGCAATCCTGGC -3'
Posted On2013-04-24