Incidental Mutation 'R0350:Sox9'
ID29663
Institutional Source Beutler Lab
Gene Symbol Sox9
Ensembl Gene ENSMUSG00000000567
Gene NameSRY (sex determining region Y)-box 9
Synonyms2010306G03Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location112782224-112787760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112784876 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 297 (Y297C)
Ref Sequence ENSEMBL: ENSMUSP00000000579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000579]
Predicted Effect probably damaging
Transcript: ENSMUST00000000579
AA Change: Y297C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000579
Gene: ENSMUSG00000000567
AA Change: Y297C

DomainStartEndE-ValueType
Pfam:Sox_N 22 94 9.6e-29 PFAM
HMG 104 174 2.34e-27 SMART
low complexity region 186 196 N/A INTRINSIC
low complexity region 234 241 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137081
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutant heterozygotes and conditional knockout mutants display perinatal lethality with cleft palate, hypoplasia and distortion of numerous cartilage-derived skeletal structures, and premature mineralization in many bones. Specific conditional knockout mutations are sex-reversed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Sox9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Sox9 APN 11 112784674 missense probably benign 0.00
IGL02257:Sox9 APN 11 112784985 missense possibly damaging 0.84
IGL02935:Sox9 APN 11 112785349 missense probably damaging 0.99
R0634:Sox9 UTSW 11 112784942 missense probably damaging 0.98
R4273:Sox9 UTSW 11 112785154 missense possibly damaging 0.60
R4692:Sox9 UTSW 11 112782977 missense probably benign 0.01
R5328:Sox9 UTSW 11 112782658 missense probably benign 0.39
R5501:Sox9 UTSW 11 112783859 missense probably damaging 1.00
R5905:Sox9 UTSW 11 112783820 missense probably damaging 1.00
R6707:Sox9 UTSW 11 112782872 missense probably damaging 0.99
R6834:Sox9 UTSW 11 112784000 missense probably benign 0.01
R7897:Sox9 UTSW 11 112784809 missense probably benign 0.22
Z1176:Sox9 UTSW 11 112785122 missense possibly damaging 0.51
Z1177:Sox9 UTSW 11 112784803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GCTGGCAAAGTTGATCTGAAGCGAG -3'
(R):5'- TCAGCGTAGTCGTATTGCGAGC -3'

Sequencing Primer
(F):5'- TTGATCTGAAGCGAGAGGGG -3'
(R):5'- AGTGCTGCTGCTGCTCG -3'
Posted On2013-04-24