Mutagenetix > Incidental Mutations

Incidental Mutation 'R0350:Taf1b'

29664

Institutional Source

Beutler Lab

Gene Symbol

Taf1b

Ensembl Gene

ENSMUSG00000059669

Gene Name

TATA-box binding protein associated factor, RNA polymerase I, B

Synonyms

A230108M10Rik, mTAFI68, p63, 4930408G01Rik

MMRRC Submission

038557-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R0350 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24498359-24558539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24514885 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 167 (D167G)

Ref Sequence

ENSEMBL: ENSMUSP00000075339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075954
AA Change: D167G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669
AA Change: D167G

Domain	Start	End	E-Value	Type
Pfam:RRN7	3	39	7.3e-15	PFAM
low complexity region	141	153	N/A	INTRINSIC
low complexity region	361	374	N/A	INTRINSIC
low complexity region	411	425	N/A	INTRINSIC
low complexity region	574	583	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220562

Predicted Effect

probably benign
Transcript: ENSMUST00000221372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223503

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.2%
20x: 89.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd13	T	A	8: 9,987,600	Y66N	probably damaging	Het
Apol6	C	T	15: 77,050,947	Q139*	probably null	Het
Armh1	C	A	4: 117,215,556	E244*	probably null	Het
BC052040	T	C	2: 115,776,930	Y255H	possibly damaging	Het
Ccdc130	C	T	8: 84,260,648	E99K	probably damaging	Het
Cd1d1	A	T	3: 86,997,573	H219Q	probably benign	Het
Cdca2	A	G	14: 67,713,119	L121P	probably benign	Het
Cog4	T	A	8: 110,853,696	L133I	possibly damaging	Het
Csf1	T	C	3: 107,748,606	M370V	probably benign	Het
Ddi2	G	A	4: 141,685,523	T26M	probably benign	Het
Dhcr7	A	G	7: 143,837,770	D32G	probably damaging	Het
Exd1	T	C	2: 119,523,566	N337S	possibly damaging	Het
Flii	T	C	11: 60,721,857	D227G	probably damaging	Het
Gm11639	T	C	11: 104,690,880	V16A	probably benign	Het
Hsf1	A	G	15: 76,500,479	T485A	probably benign	Het
Igfn1	G	A	1: 135,956,767	R2614*	probably null	Het
Iqch	T	C	9: 63,500,876	T630A	probably benign	Het
Itgal	T	A	7: 127,322,081	D770E	probably damaging	Het
Mroh1	T	A	15: 76,432,249	V759E	probably damaging	Het
Mrps17	A	G	5: 129,718,145		probably benign	Het
Mtpap	A	G	18: 4,396,195	S496G	possibly damaging	Het
Nkd1	T	A	8: 88,585,216	Y39*	probably null	Het
Nmd3	A	G	3: 69,743,574	Y359C	probably damaging	Het
Nr1h3	G	A	2: 91,191,825	L153F	possibly damaging	Het
Nuf2	T	A	1: 169,513,543		probably null	Het
Olfr1218	T	A	2: 89,055,356	K23N	probably benign	Het
Olfr1272	T	C	2: 90,282,582		probably null	Het
Olfr870	A	T	9: 20,170,736	Y278*	probably null	Het
Pnn	T	C	12: 59,067,117		probably null	Het
Ppm1j	A	G	3: 104,783,371	D230G	probably benign	Het
Ppp1r15a	A	T	7: 45,523,018	L650Q	probably damaging	Het
Prss37	T	C	6: 40,514,959	E229G	probably damaging	Het
Rbm19	T	C	5: 120,128,307	V465A	possibly damaging	Het
Rubcnl	G	T	14: 75,040,891	V372F	probably damaging	Het
Sema6a	G	T	18: 47,270,718	D595E	probably benign	Het
Slc35c1	A	G	2: 92,459,032	F43S	probably damaging	Het
Slc39a5	C	T	10: 128,396,750		probably null	Het
Slco4c1	A	G	1: 96,828,849	F583L	probably benign	Het
Sox9	A	G	11: 112,784,876	Y297C	probably damaging	Het
Trpm6	T	C	19: 18,883,957		probably null	Het
Uba6	A	C	5: 86,144,378	V402G	possibly damaging	Het
Usp43	T	C	11: 67,876,498	Y682C	probably damaging	Het
Vmn1r195	A	G	13: 22,279,233	D291G	probably damaging	Het
Xpr1	A	T	1: 155,330,468	F156Y	probably damaging	Het
Zfp318	T	A	17: 46,413,198	H2042Q	probably benign	Het
Zfp937	T	A	2: 150,239,302	D417E	possibly damaging	Het

Other mutations in Taf1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Taf1b	APN	12	24547067	missense	possibly damaging	0.86
IGL01460:Taf1b	APN	12	24558246	missense	possibly damaging	0.96
IGL02100:Taf1b	APN	12	24544395	missense	possibly damaging	0.96
IGL02305:Taf1b	APN	12	24544271	missense	possibly damaging	0.73
IGL02729:Taf1b	APN	12	24547625	splice site	probably benign
PIT4283001:Taf1b	UTSW	12	24547595	missense	possibly damaging	0.86
PIT4519001:Taf1b	UTSW	12	24547119	nonsense	probably null
R0853:Taf1b	UTSW	12	24514828	missense	probably benign	0.06
R1023:Taf1b	UTSW	12	24509559	utr 3 prime	probably benign
R1604:Taf1b	UTSW	12	24556624	missense	probably benign
R1702:Taf1b	UTSW	12	24509126	missense	possibly damaging	0.73
R1743:Taf1b	UTSW	12	24547178	missense	possibly damaging	0.85
R1817:Taf1b	UTSW	12	24547122	missense	possibly damaging	0.70
R1873:Taf1b	UTSW	12	24556669	missense	possibly damaging	0.96
R4595:Taf1b	UTSW	12	24500442	missense	possibly damaging	0.85
R5280:Taf1b	UTSW	12	24549438	missense	probably benign	0.18
R5838:Taf1b	UTSW	12	24500449	missense	possibly damaging	0.92
R5849:Taf1b	UTSW	12	24500525	missense	probably damaging	1.00
R6368:Taf1b	UTSW	12	24558257	missense	possibly damaging	0.53
R6529:Taf1b	UTSW	12	24556651	missense	possibly damaging	0.53
R6589:Taf1b	UTSW	12	24556528	missense	possibly damaging	0.72
R6879:Taf1b	UTSW	12	24500517	missense	possibly damaging	0.71
R7342:Taf1b	UTSW	12	24558344	nonsense	probably null
R7449:Taf1b	UTSW	12	24504993	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AGAAAGGACTCTCAGATGCACTGACAA -3'
(R):5'- CTGAATGCCGCCTATGGCAGTAATAA -3'

Sequencing Primer
(F):5'- TGCACTGACAAGCAGTAGC -3'
(R):5'- gccagagaggaaaccagatac -3'

Posted On

2013-04-24