Incidental Mutation 'R0350:Taf1b'
ID29664
Institutional Source Beutler Lab
Gene Symbol Taf1b
Ensembl Gene ENSMUSG00000059669
Gene NameTATA-box binding protein associated factor, RNA polymerase I, B
SynonymsA230108M10Rik, mTAFI68, p63, 4930408G01Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location24498359-24558539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24514885 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000075339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075954] [ENSMUST00000221372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075954
AA Change: D167G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075339
Gene: ENSMUSG00000059669
AA Change: D167G

DomainStartEndE-ValueType
Pfam:RRN7 3 39 7.3e-15 PFAM
low complexity region 141 153 N/A INTRINSIC
low complexity region 361 374 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
low complexity region 574 583 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220562
Predicted Effect probably benign
Transcript: ENSMUST00000221372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223503
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes one of the SL1-specific TAFs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Taf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Taf1b APN 12 24547067 missense possibly damaging 0.86
IGL01460:Taf1b APN 12 24558246 missense possibly damaging 0.96
IGL02100:Taf1b APN 12 24544395 missense possibly damaging 0.96
IGL02305:Taf1b APN 12 24544271 missense possibly damaging 0.73
IGL02729:Taf1b APN 12 24547625 splice site probably benign
PIT4283001:Taf1b UTSW 12 24547595 missense possibly damaging 0.86
PIT4519001:Taf1b UTSW 12 24547119 nonsense probably null
R0853:Taf1b UTSW 12 24514828 missense probably benign 0.06
R1023:Taf1b UTSW 12 24509559 utr 3 prime probably benign
R1604:Taf1b UTSW 12 24556624 missense probably benign
R1702:Taf1b UTSW 12 24509126 missense possibly damaging 0.73
R1743:Taf1b UTSW 12 24547178 missense possibly damaging 0.85
R1817:Taf1b UTSW 12 24547122 missense possibly damaging 0.70
R1873:Taf1b UTSW 12 24556669 missense possibly damaging 0.96
R4595:Taf1b UTSW 12 24500442 missense possibly damaging 0.85
R5280:Taf1b UTSW 12 24549438 missense probably benign 0.18
R5838:Taf1b UTSW 12 24500449 missense possibly damaging 0.92
R5849:Taf1b UTSW 12 24500525 missense probably damaging 1.00
R6368:Taf1b UTSW 12 24558257 missense possibly damaging 0.53
R6529:Taf1b UTSW 12 24556651 missense possibly damaging 0.53
R6589:Taf1b UTSW 12 24556528 missense possibly damaging 0.72
R6879:Taf1b UTSW 12 24500517 missense possibly damaging 0.71
R7342:Taf1b UTSW 12 24558344 nonsense probably null
R7449:Taf1b UTSW 12 24504993 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGAAAGGACTCTCAGATGCACTGACAA -3'
(R):5'- CTGAATGCCGCCTATGGCAGTAATAA -3'

Sequencing Primer
(F):5'- TGCACTGACAAGCAGTAGC -3'
(R):5'- gccagagaggaaaccagatac -3'
Posted On2013-04-24