Incidental Mutation 'R0350:Rubcnl'
ID29668
Institutional Source Beutler Lab
Gene Symbol Rubcnl
Ensembl Gene ENSMUSG00000034959
Gene NameRUN and cysteine rich domain containing beclin 1 interacting protein like
SynonymsLOC380917, 5031414D18Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75016027-75052532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75040891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 372 (V372F)
Ref Sequence ENSEMBL: ENSMUSP00000045566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036072]
Predicted Effect probably damaging
Transcript: ENSMUST00000036072
AA Change: V372F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045566
Gene: ENSMUSG00000034959
AA Change: V372F

DomainStartEndE-ValueType
DUF4206 463 664 1.01e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228689
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Rubcnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02571:Rubcnl APN 14 75032136 missense possibly damaging 0.75
IGL02730:Rubcnl APN 14 75050148 missense probably damaging 1.00
R0019:Rubcnl UTSW 14 75048263 splice site probably benign
R0147:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0148:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0487:Rubcnl UTSW 14 75036081 missense probably benign 0.18
R0558:Rubcnl UTSW 14 75047547 missense probably damaging 1.00
R1537:Rubcnl UTSW 14 75040827 missense possibly damaging 0.92
R1791:Rubcnl UTSW 14 75047549 missense probably damaging 1.00
R1871:Rubcnl UTSW 14 75042409 missense possibly damaging 0.58
R2227:Rubcnl UTSW 14 75042392 missense probably benign 0.00
R2263:Rubcnl UTSW 14 75040820 missense possibly damaging 0.93
R2910:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R2911:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R3826:Rubcnl UTSW 14 75032225 missense possibly damaging 0.72
R3870:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R3871:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R4007:Rubcnl UTSW 14 75049703 missense possibly damaging 0.93
R4161:Rubcnl UTSW 14 75044458 missense possibly damaging 0.82
R5004:Rubcnl UTSW 14 75032177 nonsense probably null
R5041:Rubcnl UTSW 14 75050132 missense probably damaging 1.00
R5468:Rubcnl UTSW 14 75032031 missense possibly damaging 0.49
R5495:Rubcnl UTSW 14 75042337 missense possibly damaging 0.61
R5739:Rubcnl UTSW 14 75040941 splice site probably null
R5910:Rubcnl UTSW 14 75035472 missense probably benign 0.26
R5948:Rubcnl UTSW 14 75047616 missense probably damaging 1.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6197:Rubcnl UTSW 14 75031929 missense probably damaging 0.99
R6297:Rubcnl UTSW 14 75050144 missense probably benign 0.06
R6372:Rubcnl UTSW 14 75047569 missense probably damaging 0.99
R6376:Rubcnl UTSW 14 75032394 missense probably benign 0.01
R6377:Rubcnl UTSW 14 75050195 splice site probably null
R6724:Rubcnl UTSW 14 75052010 missense probably benign 0.00
R6884:Rubcnl UTSW 14 75035470 missense probably benign 0.23
R7183:Rubcnl UTSW 14 75049626 missense probably damaging 0.97
R7186:Rubcnl UTSW 14 75032013 missense possibly damaging 0.91
R7345:Rubcnl UTSW 14 75042353 missense probably benign
R7423:Rubcnl UTSW 14 75049643 missense probably benign 0.09
R7548:Rubcnl UTSW 14 75042352 missense probably benign
R7606:Rubcnl UTSW 14 75038874 missense probably benign 0.41
R7699:Rubcnl UTSW 14 75031964 missense probably benign
R7781:Rubcnl UTSW 14 75032090 missense probably damaging 1.00
R8406:Rubcnl UTSW 14 75051985 missense probably damaging 1.00
RF011:Rubcnl UTSW 14 75044438 missense probably damaging 0.99
Z1176:Rubcnl UTSW 14 75036197 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACATCAGATGCTCAGCTTTGCAAC -3'
(R):5'- ACCTCAGGATACTTGAGAGTACGGC -3'

Sequencing Primer
(F):5'- GTGCTTAGCCAGAGAGTTGTTC -3'
(R):5'- gcacaccacagcgagac -3'
Posted On2013-04-24