Incidental Mutation 'R0350:Hsf1'
ID29670
Institutional Source Beutler Lab
Gene Symbol Hsf1
Ensembl Gene ENSMUSG00000022556
Gene Nameheat shock factor 1
Synonymsheat shock transcription factor 1
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76477422-76501913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76500479 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 485 (T485A)
Ref Sequence ENSEMBL: ENSMUSP00000154638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000229363] [ENSMUST00000228868]
Predicted Effect probably benign
Transcript: ENSMUST00000023214
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
AA Change: T457A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556
AA Change: T457A

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160293
SMART Domains Protein: ENSMUSP00000123779
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
Pfam:MBOAT 41 201 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162813
Predicted Effect unknown
Transcript: ENSMUST00000226238
AA Change: T205A
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
Predicted Effect probably benign
Transcript: ENSMUST00000227478
AA Change: T479A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227921
Predicted Effect probably benign
Transcript: ENSMUST00000228371
AA Change: T485A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228781
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230505
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phsphorylation, which promotes binding by heat shock protein 90. [provided by RefSeq, Aug 2016]
PHENOTYPE: Inactivation of this gene results in female infertility. Additional abnormalities observed in one line of targeted mice include placental defects, growth retardation, loss of the classical heat shock response, and impaired immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Hsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Hsf1 APN 15 76498203 missense probably benign 0.01
IGL01668:Hsf1 APN 15 76496962 critical splice donor site probably null
IGL01724:Hsf1 APN 15 76496837 missense possibly damaging 0.83
IGL02111:Hsf1 APN 15 76496081 splice site probably benign
IGL02503:Hsf1 APN 15 76498670 missense probably benign 0.03
IGL03137:Hsf1 APN 15 76496449 splice site probably benign
R6906:Hsf1 UTSW 15 76477719 critical splice donor site probably null
R7170:Hsf1 UTSW 15 76500021 missense probably damaging 1.00
R7749:Hsf1 UTSW 15 76499187 missense probably benign 0.38
R7950:Hsf1 UTSW 15 76498193 missense probably benign
R8050:Hsf1 UTSW 15 76498281 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTGAGGCAGAGAACAGTAACCCCG -3'
(R):5'- TACTGCCCAGGACCAAGTTCCATC -3'

Sequencing Primer
(F):5'- GACTCAGGTGAGAGCTAAGCTTC -3'
(R):5'- AGGACCAAGTTCCATCTGTGC -3'
Posted On2013-04-24