Incidental Mutation 'R0350:Apol6'
ID29671
Institutional Source Beutler Lab
Gene Symbol Apol6
Ensembl Gene ENSMUSG00000033576
Gene Nameapolipoprotein L 6
Synonyms
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77044729-77057106 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 77050947 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 139 (Q139*)
Ref Sequence ENSEMBL: ENSMUSP00000121308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127957] [ENSMUST00000129468] [ENSMUST00000142405] [ENSMUST00000149569] [ENSMUST00000152949] [ENSMUST00000166179] [ENSMUST00000229423]
Predicted Effect probably null
Transcript: ENSMUST00000127957
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000118257
Gene: ENSMUSG00000033576
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:ApoL 15 290 4.1e-76 PFAM
transmembrane domain 294 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139304
Predicted Effect probably benign
Transcript: ENSMUST00000142405
SMART Domains Protein: ENSMUSP00000117135
Gene: ENSMUSG00000033576

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148197
Predicted Effect probably null
Transcript: ENSMUST00000149569
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000120866
Gene: ENSMUSG00000033576
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:ApoL 10 290 7e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152949
AA Change: Q139*
SMART Domains Protein: ENSMUSP00000121308
Gene: ENSMUSG00000033576
AA Change: Q139*

DomainStartEndE-ValueType
Pfam:ApoL 10 263 2.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166179
SMART Domains Protein: ENSMUSP00000128399
Gene: ENSMUSG00000018893

DomainStartEndE-ValueType
Pfam:Globin 7 113 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229423
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Mtpap A G 18: 4,396,195 S496G possibly damaging Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Apol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Apol6 APN 15 77050716 missense probably damaging 1.00
IGL01788:Apol6 APN 15 77051016 missense possibly damaging 0.81
FR4304:Apol6 UTSW 15 77051436 frame shift probably null
FR4449:Apol6 UTSW 15 77051443 nonsense probably null
FR4548:Apol6 UTSW 15 77051445 frame shift probably null
FR4589:Apol6 UTSW 15 77051438 frame shift probably null
FR4737:Apol6 UTSW 15 77051442 frame shift probably null
R1167:Apol6 UTSW 15 77047108 nonsense probably null
R1906:Apol6 UTSW 15 77050860 missense probably damaging 0.99
R1996:Apol6 UTSW 15 77050756 missense probably benign 0.28
R2097:Apol6 UTSW 15 77047133 critical splice donor site probably null
R5611:Apol6 UTSW 15 77051040 splice site probably null
R5980:Apol6 UTSW 15 77051019 missense possibly damaging 0.66
R6191:Apol6 UTSW 15 77055898 missense probably benign 0.00
R6300:Apol6 UTSW 15 77051271 missense probably benign 0.01
R6519:Apol6 UTSW 15 77051276 nonsense probably null
R7569:Apol6 UTSW 15 77050698 unclassified probably benign
R8072:Apol6 UTSW 15 77051103 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTATCGCAGACCACATTGACG -3'
(R):5'- TGTGTTCAGCTAACACCCGCTC -3'

Sequencing Primer
(F):5'- AAAGTGGTGACTACCTCTGC -3'
(R):5'- CACTTCGAGCTGATACGTGG -3'
Posted On2013-04-24