Incidental Mutation 'R0350:Mtpap'
ID29673
Institutional Source Beutler Lab
Gene Symbol Mtpap
Ensembl Gene ENSMUSG00000024234
Gene Namemitochondrial poly(A) polymerase
SynonymsPapd1, 0610027A18Rik
MMRRC Submission 038557-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0350 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4375592-4397330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4396195 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 496 (S496G)
Ref Sequence ENSEMBL: ENSMUSP00000025077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025077
AA Change: S496G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025077
Gene: ENSMUSG00000024234
AA Change: S496G

DomainStartEndE-ValueType
PDB:3PQ1|B 44 528 N/A PDB
SCOP:d1f5aa2 187 523 1e-35 SMART
low complexity region 529 538 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DNA polymerase type-B-like family. This enzyme synthesizes the 3' poly(A) tail of mitochondrial transcripts and plays a role in replication-dependent histone mRNA degradation.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T A 8: 9,987,600 Y66N probably damaging Het
Apol6 C T 15: 77,050,947 Q139* probably null Het
Armh1 C A 4: 117,215,556 E244* probably null Het
BC052040 T C 2: 115,776,930 Y255H possibly damaging Het
Ccdc130 C T 8: 84,260,648 E99K probably damaging Het
Cd1d1 A T 3: 86,997,573 H219Q probably benign Het
Cdca2 A G 14: 67,713,119 L121P probably benign Het
Cog4 T A 8: 110,853,696 L133I possibly damaging Het
Csf1 T C 3: 107,748,606 M370V probably benign Het
Ddi2 G A 4: 141,685,523 T26M probably benign Het
Dhcr7 A G 7: 143,837,770 D32G probably damaging Het
Exd1 T C 2: 119,523,566 N337S possibly damaging Het
Flii T C 11: 60,721,857 D227G probably damaging Het
Gm11639 T C 11: 104,690,880 V16A probably benign Het
Hsf1 A G 15: 76,500,479 T485A probably benign Het
Igfn1 G A 1: 135,956,767 R2614* probably null Het
Iqch T C 9: 63,500,876 T630A probably benign Het
Itgal T A 7: 127,322,081 D770E probably damaging Het
Mroh1 T A 15: 76,432,249 V759E probably damaging Het
Mrps17 A G 5: 129,718,145 probably benign Het
Nkd1 T A 8: 88,585,216 Y39* probably null Het
Nmd3 A G 3: 69,743,574 Y359C probably damaging Het
Nr1h3 G A 2: 91,191,825 L153F possibly damaging Het
Nuf2 T A 1: 169,513,543 probably null Het
Olfr1218 T A 2: 89,055,356 K23N probably benign Het
Olfr1272 T C 2: 90,282,582 probably null Het
Olfr870 A T 9: 20,170,736 Y278* probably null Het
Pnn T C 12: 59,067,117 probably null Het
Ppm1j A G 3: 104,783,371 D230G probably benign Het
Ppp1r15a A T 7: 45,523,018 L650Q probably damaging Het
Prss37 T C 6: 40,514,959 E229G probably damaging Het
Rbm19 T C 5: 120,128,307 V465A possibly damaging Het
Rubcnl G T 14: 75,040,891 V372F probably damaging Het
Sema6a G T 18: 47,270,718 D595E probably benign Het
Slc35c1 A G 2: 92,459,032 F43S probably damaging Het
Slc39a5 C T 10: 128,396,750 probably null Het
Slco4c1 A G 1: 96,828,849 F583L probably benign Het
Sox9 A G 11: 112,784,876 Y297C probably damaging Het
Taf1b A G 12: 24,514,885 D167G possibly damaging Het
Trpm6 T C 19: 18,883,957 probably null Het
Uba6 A C 5: 86,144,378 V402G possibly damaging Het
Usp43 T C 11: 67,876,498 Y682C probably damaging Het
Vmn1r195 A G 13: 22,279,233 D291G probably damaging Het
Xpr1 A T 1: 155,330,468 F156Y probably damaging Het
Zfp318 T A 17: 46,413,198 H2042Q probably benign Het
Zfp937 T A 2: 150,239,302 D417E possibly damaging Het
Other mutations in Mtpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Mtpap APN 18 4379670 missense probably damaging 0.99
IGL00848:Mtpap APN 18 4380717 missense probably benign 0.00
IGL02659:Mtpap APN 18 4380703 nonsense probably null
IGL02828:Mtpap APN 18 4386207 missense probably damaging 0.99
IGL03006:Mtpap APN 18 4375721 missense possibly damaging 0.49
R0031:Mtpap UTSW 18 4383244 missense probably damaging 0.96
R3787:Mtpap UTSW 18 4380670 missense probably damaging 1.00
R4381:Mtpap UTSW 18 4383223 missense probably benign 0.04
R4698:Mtpap UTSW 18 4375724 missense possibly damaging 0.59
R4717:Mtpap UTSW 18 4396394 missense possibly damaging 0.82
R4850:Mtpap UTSW 18 4387044 missense probably damaging 1.00
R4963:Mtpap UTSW 18 4375638 missense probably benign 0.05
R4982:Mtpap UTSW 18 4396332 missense probably benign 0.01
R5059:Mtpap UTSW 18 4375827 intron probably benign
R5311:Mtpap UTSW 18 4386328 missense probably damaging 1.00
R5600:Mtpap UTSW 18 4379674 missense probably damaging 1.00
R5713:Mtpap UTSW 18 4396280 missense probably benign 0.00
R6312:Mtpap UTSW 18 4396175 missense possibly damaging 0.89
R7006:Mtpap UTSW 18 4380873 missense possibly damaging 0.63
R7059:Mtpap UTSW 18 4396202 missense probably damaging 1.00
R7117:Mtpap UTSW 18 4380889 critical splice donor site probably null
R7286:Mtpap UTSW 18 4387068 missense probably benign 0.20
R7452:Mtpap UTSW 18 4379705 missense possibly damaging 0.75
R7845:Mtpap UTSW 18 4387134 missense possibly damaging 0.56
R7868:Mtpap UTSW 18 4380673 missense probably damaging 1.00
R8390:Mtpap UTSW 18 4396141 missense probably damaging 0.99
X0025:Mtpap UTSW 18 4375710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAACAACCTGGTCATATCTGCAC -3'
(R):5'- GTTCAAAAGGCTGCATCATGCCTG -3'

Sequencing Primer
(F):5'- GGTCATATCTGCACTCATCTAAATGC -3'
(R):5'- GGATGCTAACAAGCCTTTGAC -3'
Posted On2013-04-24