Incidental Mutation 'R0352:Clcn6'
ID 29695
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Name chloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 038558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R0352 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 148088716-148123270 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148099063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 427 (S427P)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]
AlphaFold O35454
Predicted Effect probably damaging
Transcript: ENSMUST00000030879
AA Change: S424P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: S424P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105711
AA Change: S427P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: S427P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137724
AA Change: S427P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: S427P

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,184,804 (GRCm39) T64M possibly damaging Het
3110040N11Rik G T 7: 81,438,208 (GRCm39) N49K probably benign Het
Adrb1 T A 19: 56,711,293 (GRCm39) F164I probably damaging Het
Aplf C T 6: 87,630,866 (GRCm39) V190I probably benign Het
Aqr A G 2: 114,000,533 (GRCm39) Y50H probably damaging Het
Arfgef3 A C 10: 18,537,135 (GRCm39) I182R probably benign Het
Cacna1b G A 2: 24,515,244 (GRCm39) probably benign Het
Casp9 A G 4: 141,532,841 (GRCm39) T246A probably damaging Het
Cnga1 T C 5: 72,761,846 (GRCm39) N556S possibly damaging Het
Cntnap2 G A 6: 45,969,018 (GRCm39) probably null Het
Col11a2 T G 17: 34,261,501 (GRCm39) V120G probably benign Het
Cux2 A C 5: 122,022,802 (GRCm39) probably benign Het
Dmrt2 T C 19: 25,656,026 (GRCm39) S542P probably damaging Het
Dnah7b A G 1: 46,316,286 (GRCm39) H3133R probably damaging Het
Drosha G A 15: 12,837,374 (GRCm39) R286Q unknown Het
Eipr1 A G 12: 28,816,784 (GRCm39) D47G probably damaging Het
Fras1 T G 5: 96,874,399 (GRCm39) Y2275D probably damaging Het
Grm4 C T 17: 27,670,865 (GRCm39) probably benign Het
Hebp1 A G 6: 135,129,918 (GRCm39) V100A possibly damaging Het
Hivep2 G A 10: 14,019,039 (GRCm39) V1937I possibly damaging Het
Hs3st6 T C 17: 24,977,168 (GRCm39) V216A probably damaging Het
Hsd17b4 T C 18: 50,324,851 (GRCm39) I688T probably benign Het
Hydin T C 8: 111,296,533 (GRCm39) probably null Het
Iws1 A G 18: 32,217,258 (GRCm39) E426G probably damaging Het
Klrb1f T C 6: 129,030,680 (GRCm39) S64P probably damaging Het
Lacc1 C T 14: 77,272,629 (GRCm39) G56R probably damaging Het
Lcmt2 A G 2: 120,969,377 (GRCm39) S569P probably benign Het
Lipm C T 19: 34,090,275 (GRCm39) probably benign Het
Lum A G 10: 97,404,471 (GRCm39) H122R probably damaging Het
Magi2 A G 5: 20,270,664 (GRCm39) Y15C probably damaging Het
Mal A T 2: 127,482,286 (GRCm39) I39N probably damaging Het
Mgme1 A G 2: 144,118,319 (GRCm39) H197R probably benign Het
Mmrn1 A T 6: 60,921,955 (GRCm39) K137N probably benign Het
Myh3 T A 11: 66,981,254 (GRCm39) C706S possibly damaging Het
Myo18b A T 5: 113,022,389 (GRCm39) probably benign Het
Myom1 A G 17: 71,352,744 (GRCm39) E356G possibly damaging Het
Nfib A G 4: 82,422,954 (GRCm39) probably benign Het
Npc1l1 T C 11: 6,173,076 (GRCm39) M788V probably benign Het
Or9a2 C T 6: 41,749,058 (GRCm39) M58I probably damaging Het
Pdha2 A G 3: 140,917,457 (GRCm39) V17A probably benign Het
Pgap1 A T 1: 54,525,617 (GRCm39) probably benign Het
Polr1a G T 6: 71,897,747 (GRCm39) probably benign Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Pramel20 A T 4: 143,297,878 (GRCm39) probably benign Het
Pramel21 A T 4: 143,342,559 (GRCm39) D222V possibly damaging Het
Prmt2 A T 10: 76,044,337 (GRCm39) V405D possibly damaging Het
Psg26 T A 7: 18,209,181 (GRCm39) Y409F probably benign Het
Psme3ip1 A G 8: 95,314,639 (GRCm39) F73S probably damaging Het
Ptges G T 2: 30,793,144 (GRCm39) Y29* probably null Het
Ptrhd1 A G 12: 4,286,399 (GRCm39) T97A probably benign Het
Ripk3 T A 14: 56,024,200 (GRCm39) probably benign Het
Rnf114 A T 2: 167,353,136 (GRCm39) I136F probably benign Het
Serinc5 A G 13: 92,844,497 (GRCm39) probably null Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc23a2 C A 2: 131,902,716 (GRCm39) M495I probably benign Het
Slc52a3 T A 2: 151,849,433 (GRCm39) L360* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Syt5 A G 7: 4,544,170 (GRCm39) V290A probably benign Het
Szt2 G A 4: 118,239,790 (GRCm39) A1931V unknown Het
Tasp1 A G 2: 139,793,378 (GRCm39) probably null Het
Tcp10a C A 17: 7,593,805 (GRCm39) D43E probably damaging Het
Tnfsf11 A T 14: 78,516,408 (GRCm39) Y187N probably benign Het
Tppp2 T A 14: 52,156,807 (GRCm39) N61K possibly damaging Het
Wwtr1 A T 3: 57,482,548 (GRCm39) W100R probably damaging Het
Zfp623 A G 15: 75,820,433 (GRCm39) D463G probably benign Het
Zfp990 A G 4: 145,263,174 (GRCm39) I57M probably damaging Het
Zmat5 G A 11: 4,672,413 (GRCm39) C10Y probably damaging Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148,102,359 (GRCm39) critical splice donor site probably null
IGL00434:Clcn6 APN 4 148,098,195 (GRCm39) missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148,098,245 (GRCm39) splice site probably benign
IGL01384:Clcn6 APN 4 148,103,423 (GRCm39) missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148,105,908 (GRCm39) splice site probably benign
IGL01522:Clcn6 APN 4 148,101,992 (GRCm39) missense probably benign 0.44
R0194:Clcn6 UTSW 4 148,097,213 (GRCm39) missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148,093,172 (GRCm39) missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148,108,651 (GRCm39) missense possibly damaging 0.89
R0586:Clcn6 UTSW 4 148,123,206 (GRCm39) unclassified probably benign
R0927:Clcn6 UTSW 4 148,113,849 (GRCm39) missense probably benign 0.30
R1141:Clcn6 UTSW 4 148,098,356 (GRCm39) missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148,098,358 (GRCm39) missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148,098,358 (GRCm39) missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148,108,613 (GRCm39) missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148,097,235 (GRCm39) missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148,097,226 (GRCm39) missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148,099,051 (GRCm39) missense probably benign
R1596:Clcn6 UTSW 4 148,107,836 (GRCm39) missense probably damaging 1.00
R1706:Clcn6 UTSW 4 148,102,025 (GRCm39) missense probably benign 0.00
R1769:Clcn6 UTSW 4 148,098,758 (GRCm39) splice site probably null
R2021:Clcn6 UTSW 4 148,095,109 (GRCm39) critical splice donor site probably null
R2022:Clcn6 UTSW 4 148,095,109 (GRCm39) critical splice donor site probably null
R2049:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148,095,525 (GRCm39) missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148,108,594 (GRCm39) missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148,099,057 (GRCm39) missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148,101,951 (GRCm39) critical splice donor site probably null
R2891:Clcn6 UTSW 4 148,097,073 (GRCm39) critical splice donor site probably null
R3750:Clcn6 UTSW 4 148,108,644 (GRCm39) nonsense probably null
R4014:Clcn6 UTSW 4 148,102,067 (GRCm39) missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148,098,740 (GRCm39) missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148,108,624 (GRCm39) missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148,104,223 (GRCm39) missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148,093,227 (GRCm39) missense probably benign 0.05
R5140:Clcn6 UTSW 4 148,122,774 (GRCm39) unclassified probably benign
R5345:Clcn6 UTSW 4 148,123,206 (GRCm39) unclassified probably benign
R5467:Clcn6 UTSW 4 148,102,093 (GRCm39) missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148,099,018 (GRCm39) missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148,098,646 (GRCm39) missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148,102,049 (GRCm39) missense probably benign 0.01
R6043:Clcn6 UTSW 4 148,093,245 (GRCm39) missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148,101,957 (GRCm39) missense probably benign 0.01
R6593:Clcn6 UTSW 4 148,095,226 (GRCm39) missense probably benign 0.21
R7440:Clcn6 UTSW 4 148,098,652 (GRCm39) missense probably damaging 1.00
R7674:Clcn6 UTSW 4 148,097,151 (GRCm39) missense probably damaging 1.00
R7756:Clcn6 UTSW 4 148,113,896 (GRCm39) missense probably damaging 1.00
R7901:Clcn6 UTSW 4 148,095,202 (GRCm39) missense probably damaging 1.00
R8559:Clcn6 UTSW 4 148,111,032 (GRCm39) missense possibly damaging 0.88
R8747:Clcn6 UTSW 4 148,093,354 (GRCm39) critical splice donor site probably null
R9246:Clcn6 UTSW 4 148,113,866 (GRCm39) missense probably benign 0.25
R9343:Clcn6 UTSW 4 148,098,458 (GRCm39) missense probably benign 0.03
V7732:Clcn6 UTSW 4 148,098,412 (GRCm39) missense probably damaging 0.96
Z1177:Clcn6 UTSW 4 148,107,827 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTGCAGAGAGATGCCTGAGAG -3'
(R):5'- TCACCCACATTGTTTGAGTCCACAC -3'

Sequencing Primer
(F):5'- GATGCCTGAGAGGCAGC -3'
(R):5'- CCACGGCAGATGTGTACTTG -3'
Posted On 2013-04-24