Incidental Mutation 'R0352:Cntnap2'
ID 29701
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 038558-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0352 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 45969018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000114641
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,184,804 (GRCm39) T64M possibly damaging Het
3110040N11Rik G T 7: 81,438,208 (GRCm39) N49K probably benign Het
Adrb1 T A 19: 56,711,293 (GRCm39) F164I probably damaging Het
Aplf C T 6: 87,630,866 (GRCm39) V190I probably benign Het
Aqr A G 2: 114,000,533 (GRCm39) Y50H probably damaging Het
Arfgef3 A C 10: 18,537,135 (GRCm39) I182R probably benign Het
Cacna1b G A 2: 24,515,244 (GRCm39) probably benign Het
Casp9 A G 4: 141,532,841 (GRCm39) T246A probably damaging Het
Clcn6 A G 4: 148,099,063 (GRCm39) S427P probably damaging Het
Cnga1 T C 5: 72,761,846 (GRCm39) N556S possibly damaging Het
Col11a2 T G 17: 34,261,501 (GRCm39) V120G probably benign Het
Cux2 A C 5: 122,022,802 (GRCm39) probably benign Het
Dmrt2 T C 19: 25,656,026 (GRCm39) S542P probably damaging Het
Dnah7b A G 1: 46,316,286 (GRCm39) H3133R probably damaging Het
Drosha G A 15: 12,837,374 (GRCm39) R286Q unknown Het
Eipr1 A G 12: 28,816,784 (GRCm39) D47G probably damaging Het
Fras1 T G 5: 96,874,399 (GRCm39) Y2275D probably damaging Het
Grm4 C T 17: 27,670,865 (GRCm39) probably benign Het
Hebp1 A G 6: 135,129,918 (GRCm39) V100A possibly damaging Het
Hivep2 G A 10: 14,019,039 (GRCm39) V1937I possibly damaging Het
Hs3st6 T C 17: 24,977,168 (GRCm39) V216A probably damaging Het
Hsd17b4 T C 18: 50,324,851 (GRCm39) I688T probably benign Het
Hydin T C 8: 111,296,533 (GRCm39) probably null Het
Iws1 A G 18: 32,217,258 (GRCm39) E426G probably damaging Het
Klrb1f T C 6: 129,030,680 (GRCm39) S64P probably damaging Het
Lacc1 C T 14: 77,272,629 (GRCm39) G56R probably damaging Het
Lcmt2 A G 2: 120,969,377 (GRCm39) S569P probably benign Het
Lipm C T 19: 34,090,275 (GRCm39) probably benign Het
Lum A G 10: 97,404,471 (GRCm39) H122R probably damaging Het
Magi2 A G 5: 20,270,664 (GRCm39) Y15C probably damaging Het
Mal A T 2: 127,482,286 (GRCm39) I39N probably damaging Het
Mgme1 A G 2: 144,118,319 (GRCm39) H197R probably benign Het
Mmrn1 A T 6: 60,921,955 (GRCm39) K137N probably benign Het
Myh3 T A 11: 66,981,254 (GRCm39) C706S possibly damaging Het
Myo18b A T 5: 113,022,389 (GRCm39) probably benign Het
Myom1 A G 17: 71,352,744 (GRCm39) E356G possibly damaging Het
Nfib A G 4: 82,422,954 (GRCm39) probably benign Het
Npc1l1 T C 11: 6,173,076 (GRCm39) M788V probably benign Het
Or9a2 C T 6: 41,749,058 (GRCm39) M58I probably damaging Het
Pdha2 A G 3: 140,917,457 (GRCm39) V17A probably benign Het
Pgap1 A T 1: 54,525,617 (GRCm39) probably benign Het
Polr1a G T 6: 71,897,747 (GRCm39) probably benign Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Pramel20 A T 4: 143,297,878 (GRCm39) probably benign Het
Pramel21 A T 4: 143,342,559 (GRCm39) D222V possibly damaging Het
Prmt2 A T 10: 76,044,337 (GRCm39) V405D possibly damaging Het
Psg26 T A 7: 18,209,181 (GRCm39) Y409F probably benign Het
Psme3ip1 A G 8: 95,314,639 (GRCm39) F73S probably damaging Het
Ptges G T 2: 30,793,144 (GRCm39) Y29* probably null Het
Ptrhd1 A G 12: 4,286,399 (GRCm39) T97A probably benign Het
Ripk3 T A 14: 56,024,200 (GRCm39) probably benign Het
Rnf114 A T 2: 167,353,136 (GRCm39) I136F probably benign Het
Serinc5 A G 13: 92,844,497 (GRCm39) probably null Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc23a2 C A 2: 131,902,716 (GRCm39) M495I probably benign Het
Slc52a3 T A 2: 151,849,433 (GRCm39) L360* probably null Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Syt5 A G 7: 4,544,170 (GRCm39) V290A probably benign Het
Szt2 G A 4: 118,239,790 (GRCm39) A1931V unknown Het
Tasp1 A G 2: 139,793,378 (GRCm39) probably null Het
Tcp10a C A 17: 7,593,805 (GRCm39) D43E probably damaging Het
Tnfsf11 A T 14: 78,516,408 (GRCm39) Y187N probably benign Het
Tppp2 T A 14: 52,156,807 (GRCm39) N61K possibly damaging Het
Wwtr1 A T 3: 57,482,548 (GRCm39) W100R probably damaging Het
Zfp623 A G 15: 75,820,433 (GRCm39) D463G probably benign Het
Zfp990 A G 4: 145,263,174 (GRCm39) I57M probably damaging Het
Zmat5 G A 11: 4,672,413 (GRCm39) C10Y probably damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,965,609 (GRCm39) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTCTCCTCTCAGGGGCTGACG -3'
(R):5'- ACAATCCAGAGCTATGATCCAGTGACT -3'

Sequencing Primer
(F):5'- AACTTTGATGGCCACGGT -3'
(R):5'- tgtatgaatgatttgcctgcc -3'
Posted On 2013-04-24