Incidental Mutation 'R0352:Mmrn1'
ID29702
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Namemultimerin 1
Synonyms4921530G03Rik, Emilin4
MMRRC Submission 038558-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0352 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location60924976-60989378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60944971 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 137 (K137N)
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
Predicted Effect probably benign
Transcript: ENSMUST00000129603
AA Change: K137N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: K137N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145763
Predicted Effect probably benign
Transcript: ENSMUST00000204333
AA Change: K137N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: K137N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.0%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,138,030 T64M possibly damaging Het
3110040N11Rik G T 7: 81,788,460 N49K probably benign Het
Adrb1 T A 19: 56,722,861 F164I probably damaging Het
Aplf C T 6: 87,653,884 V190I probably benign Het
Aqr A G 2: 114,170,052 Y50H probably damaging Het
Arfgef3 A C 10: 18,661,387 I182R probably benign Het
BC080695 A T 4: 143,571,308 probably benign Het
Cacna1b G A 2: 24,625,232 probably benign Het
Casp9 A G 4: 141,805,530 T246A probably damaging Het
Clcn6 A G 4: 148,014,606 S427P probably damaging Het
Cnga1 T C 5: 72,604,503 N556S possibly damaging Het
Cntnap2 G A 6: 45,992,084 probably null Het
Col11a2 T G 17: 34,042,527 V120G probably benign Het
Cux2 A C 5: 121,884,739 probably benign Het
Dmrt2 T C 19: 25,678,662 S542P probably damaging Het
Dnah7b A G 1: 46,277,126 H3133R probably damaging Het
Drosha G A 15: 12,837,288 R286Q unknown Het
Eipr1 A G 12: 28,766,785 D47G probably damaging Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Fras1 T G 5: 96,726,540 Y2275D probably damaging Het
Gm13083 A T 4: 143,615,989 D222V possibly damaging Het
Grm4 C T 17: 27,451,891 probably benign Het
Hebp1 A G 6: 135,152,920 V100A possibly damaging Het
Hivep2 G A 10: 14,143,295 V1937I possibly damaging Het
Hs3st6 T C 17: 24,758,194 V216A probably damaging Het
Hsd17b4 T C 18: 50,191,784 I688T probably benign Het
Hydin T C 8: 110,569,901 probably null Het
Iws1 A G 18: 32,084,205 E426G probably damaging Het
Klrb1f T C 6: 129,053,717 S64P probably damaging Het
Lacc1 C T 14: 77,035,189 G56R probably damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lipm C T 19: 34,112,875 probably benign Het
Lum A G 10: 97,568,609 H122R probably damaging Het
Magi2 A G 5: 20,065,666 Y15C probably damaging Het
Mal A T 2: 127,640,366 I39N probably damaging Het
Mgme1 A G 2: 144,276,399 H197R probably benign Het
Myh3 T A 11: 67,090,428 C706S possibly damaging Het
Myo18b A T 5: 112,874,523 probably benign Het
Myom1 A G 17: 71,045,749 E356G possibly damaging Het
Nfib A G 4: 82,504,717 probably benign Het
Npc1l1 T C 11: 6,223,076 M788V probably benign Het
Olfr459 C T 6: 41,772,124 M58I probably damaging Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pgap1 A T 1: 54,486,458 probably benign Het
Polr1a G T 6: 71,920,763 probably benign Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prmt2 A T 10: 76,208,503 V405D possibly damaging Het
Psg26 T A 7: 18,475,256 Y409F probably benign Het
Ptges G T 2: 30,903,132 Y29* probably null Het
Ptrhd1 A G 12: 4,236,399 T97A probably benign Het
Ripk3 T A 14: 55,786,743 probably benign Het
Rnf114 A T 2: 167,511,216 I136F probably benign Het
Serinc5 A G 13: 92,707,989 probably null Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc23a2 C A 2: 132,060,796 M495I probably benign Het
Slc52a3 T A 2: 152,007,513 L360* probably null Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syt5 A G 7: 4,541,171 V290A probably benign Het
Szt2 G A 4: 118,382,593 A1931V unknown Het
Tasp1 A G 2: 139,951,458 probably null Het
Tcp10a C A 17: 7,326,406 D43E probably damaging Het
Tnfsf11 A T 14: 78,278,968 Y187N probably benign Het
Tppp2 T A 14: 51,919,350 N61K possibly damaging Het
Wwtr1 A T 3: 57,575,127 W100R probably damaging Het
Zfp623 A G 15: 75,948,584 D463G probably benign Het
Zfp990 A G 4: 145,536,604 I57M probably damaging Het
Zmat5 G A 11: 4,722,413 C10Y probably damaging Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R5917:Mmrn1 UTSW 6 60973150 critical splice donor site probably null
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
R7652:Mmrn1 UTSW 6 60977506 missense probably benign 0.14
R7664:Mmrn1 UTSW 6 60976705 missense probably benign 0.44
R7810:Mmrn1 UTSW 6 60976325 missense probably benign 0.18
R7915:Mmrn1 UTSW 6 60987060 splice site probably null
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Z1176:Mmrn1 UTSW 6 60945034 missense probably benign 0.37
Z1177:Mmrn1 UTSW 6 60987098 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAGGATGAAGACGCCTCACTGACC -3'
(R):5'- AGCACAAGAGACCTGTAGCATTCAC -3'

Sequencing Primer
(F):5'- CTGAAGACGATGTTCTCCTACAG -3'
(R):5'- GAGACCTGTAGCATTCACTCATAG -3'
Posted On2013-04-24