Mutagenetix > Incidental Mutation

Incidental Mutation 'R0355:Unc80'

29739

Institutional Source

Beutler Lab

Gene Symbol

Unc80

Ensembl Gene

ENSMUSG00000055567

Gene Name

unc-80, NALCN activator

Synonyms

C030018G13Rik, C230061B10Rik

MMRRC Submission

038561-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.915) question?

Stock #

R0355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66468367-66699148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66549856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1060 (H1060R)

Ref Sequence

ENSEMBL: ENSMUSP00000053692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061620
AA Change: H1060R

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: H1060R

Domain	Start	End	E-Value	Type
Pfam:UNC80	16	236	2.2e-94	PFAM
low complexity region	372	385	N/A	INTRINSIC
low complexity region	493	502	N/A	INTRINSIC
low complexity region	693	711	N/A	INTRINSIC
low complexity region	723	738	N/A	INTRINSIC
low complexity region	739	769	N/A	INTRINSIC
low complexity region	1038	1055	N/A	INTRINSIC
low complexity region	1067	1084	N/A	INTRINSIC
low complexity region	1309	1328	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1676	1681	N/A	INTRINSIC
low complexity region	1842	1848	N/A	INTRINSIC
low complexity region	1854	1868	N/A	INTRINSIC
low complexity region	2461	2480	N/A	INTRINSIC
low complexity region	2726	2740	N/A	INTRINSIC
low complexity region	3121	3144	N/A	INTRINSIC
low complexity region	3245	3254	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212557
AA Change: H1060R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.0949

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 90.2%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	G	7: 120,423,798	I52M	possibly damaging	Het
Agbl5	G	T	5: 30,891,991		probably null	Het
Akt2	T	C	7: 27,636,909		probably benign	Het
Arl6ip5	T	A	6: 97,232,417	S138T	probably damaging	Het
Atp9b	A	G	18: 80,909,585		probably benign	Het
Ccdc144b	A	G	3: 36,046,905		probably benign	Het
Ccdc171	A	T	4: 83,635,682	N422Y	probably damaging	Het
Ccr5	C	T	9: 124,124,914	P185S	possibly damaging	Het
Cep63	G	T	9: 102,623,560	Q38K	probably benign	Het
Cgn	T	C	3: 94,774,932	S446G	probably benign	Het
Col16a1	T	A	4: 130,058,413		probably benign	Het
Csmd1	T	A	8: 15,918,330	Q3099L	probably damaging	Het
Dcc	G	A	18: 71,575,208	T479I	possibly damaging	Het
Dclre1a	A	G	19: 56,546,635		probably null	Het
Dlg1	T	A	16: 31,684,174	C66*	probably null	Het
Dnah12	T	A	14: 26,706,117		probably null	Het
Dnajb9	T	A	12: 44,207,204	H140L	probably damaging	Het
Dnase1	G	A	16: 4,039,549	V237M	probably damaging	Het
Dscam	C	A	16: 96,654,905	E1274D	probably benign	Het
Epb41	T	C	4: 132,000,261	H243R	probably damaging	Het
Evc	T	A	5: 37,316,312		probably benign	Het
Fcgrt	T	A	7: 45,103,069	M1L	unknown	Het
Flii	T	C	11: 60,719,680		probably null	Het
Gen1	A	G	12: 11,248,354		probably benign	Het
Gm10447	T	C	11: 53,456,430		probably benign	Het
Gm8674	A	T	13: 49,901,939		noncoding transcript	Het
Gpr137	G	C	19: 6,939,123	D253E	probably damaging	Het
Grid2ip	A	T	5: 143,357,897	D116V	probably benign	Het
Grin2c	A	G	11: 115,260,728		probably benign	Het
Havcr1	A	G	11: 46,756,224	T162A	possibly damaging	Het
Hspa1l	A	T	17: 34,977,410	T142S	probably benign	Het
Ift140	T	A	17: 25,048,435	Y602*	probably null	Het
Il18	T	A	9: 50,579,275		probably benign	Het
Ilf3	T	C	9: 21,397,970	V474A	probably damaging	Het
Inppl1	T	C	7: 101,827,457	Y771C	probably damaging	Het
Ints2	T	C	11: 86,234,749	T542A	probably benign	Het
Ipo7	T	C	7: 110,049,661	Y714H	probably benign	Het
Itgbl1	T	A	14: 123,840,585	C162*	probably null	Het
Kcp	T	C	6: 29,496,927	H561R	possibly damaging	Het
Krt23	G	T	11: 99,485,787	T181N	probably benign	Het
Lrrc40	A	T	3: 158,040,471	D61V	probably damaging	Het
Lypd4	T	A	7: 24,865,266	H149L	probably benign	Het
Map3k4	A	G	17: 12,254,171	F953L	probably damaging	Het
Mctp1	C	T	13: 76,824,863	P405S	probably damaging	Het
Mfsd2a	G	A	4: 122,951,839	T173I	possibly damaging	Het
Mtus1	T	C	8: 41,082,928	T584A	probably benign	Het
Nell2	A	G	15: 95,432,901	V213A	probably benign	Het
Nipsnap1	G	A	11: 4,889,957	G226E	probably damaging	Het
Nudt15	T	C	14: 73,523,384	Y89C	probably damaging	Het
Olfr1341	T	A	4: 118,709,611	M68K	probably benign	Het
Olfr1353	T	G	10: 78,970,433	S261R	probably damaging	Het
Olfr63	T	A	17: 33,269,135	M137K	probably damaging	Het
Olfr978	T	A	9: 39,994,163	S118T	possibly damaging	Het
Phf24	A	C	4: 42,933,891	E91A	probably damaging	Het
Plbd1	T	A	6: 136,641,167	N17I	possibly damaging	Het
Por	C	T	5: 135,732,584	S308L	probably benign	Het
Prmt8	T	A	6: 127,711,874	K178*	probably null	Het
Rev3l	A	G	10: 39,817,286	N454S	probably damaging	Het
Rps6ka2	T	C	17: 7,271,610	V309A	probably benign	Het
Slc15a5	A	G	6: 138,018,114		probably benign	Het
Slc30a6	G	A	17: 74,423,203	V363I	probably benign	Het
Snf8	G	A	11: 96,039,299	M42I	probably benign	Het
Stom	T	C	2: 35,325,359	I65V	probably benign	Het
Tacr3	C	T	3: 134,932,228	T382I	probably benign	Het
Tenm3	A	G	8: 48,228,975	V2540A	probably damaging	Het
Trabd	A	G	15: 89,085,613	T314A	possibly damaging	Het
Tyk2	T	C	9: 21,114,190		probably null	Het
Ube4a	T	C	9: 44,944,801		probably benign	Het
Virma	A	T	4: 11,528,626	K1288*	probably null	Het
Vmn2r100	A	C	17: 19,531,320	I542L	probably benign	Het
Vwde	T	C	6: 13,187,807		probably benign	Het
Zfc3h1	T	C	10: 115,409,113	I797T	possibly damaging	Het
Zfp74	C	T	7: 29,954,041		probably benign	Het
Zkscan7	T	A	9: 122,888,807	L89Q	probably damaging	Het

Other mutations in Unc80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Unc80	APN	1	66654395	missense	possibly damaging	0.53
IGL00340:Unc80	APN	1	66606459	missense	possibly damaging	0.73
IGL00783:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00784:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00935:Unc80	APN	1	66627266	missense	possibly damaging	0.53
IGL01094:Unc80	APN	1	66695433	missense	possibly damaging	0.90
IGL01466:Unc80	APN	1	66622486	missense	probably benign	0.33
IGL01577:Unc80	APN	1	66529968	splice site	probably null
IGL01626:Unc80	APN	1	66551054	critical splice donor site	probably null
IGL01640:Unc80	APN	1	66679585	missense	probably benign	0.33
IGL01775:Unc80	APN	1	66601056	missense	possibly damaging	0.94
IGL01960:Unc80	APN	1	66608500	splice site	probably benign
IGL01991:Unc80	APN	1	66469509	nonsense	probably null
IGL02022:Unc80	APN	1	66626516	missense	possibly damaging	0.53
IGL02073:Unc80	APN	1	66612227	missense	possibly damaging	0.85
IGL02077:Unc80	APN	1	66525716	missense	possibly damaging	0.77
IGL02197:Unc80	APN	1	66530065	missense	probably benign	0.39
IGL02198:Unc80	APN	1	66529986	missense	possibly damaging	0.88
IGL02228:Unc80	APN	1	66608428	missense	possibly damaging	0.72
IGL02327:Unc80	APN	1	66641673	missense	probably benign	0.33
IGL02447:Unc80	APN	1	66503544	missense	possibly damaging	0.86
IGL02489:Unc80	APN	1	66525701	missense	probably benign	0.07
IGL02546:Unc80	APN	1	66554953	missense	possibly damaging	0.83
IGL02629:Unc80	APN	1	66483317	missense	possibly damaging	0.46
IGL02631:Unc80	APN	1	66530063	missense	probably damaging	0.98
IGL02839:Unc80	APN	1	66671675	missense	possibly damaging	0.53
IGL02960:Unc80	APN	1	66678058	splice site	probably benign
IGL02974:Unc80	APN	1	66525658	missense	possibly damaging	0.95
IGL03060:Unc80	APN	1	66637010	missense	possibly damaging	0.96
IGL03062:Unc80	APN	1	66509489	missense	probably damaging	0.96
IGL03074:Unc80	APN	1	66671718	splice site	probably benign
IGL03086:Unc80	APN	1	66509474	missense	probably damaging	0.99
IGL03105:Unc80	APN	1	66472099	missense	probably damaging	0.96
IGL03107:Unc80	APN	1	66631454	missense	probably damaging	0.98
IGL03158:Unc80	APN	1	66641674	missense	probably benign	0.33
IGL03220:Unc80	APN	1	66504938	missense	probably damaging	0.99
IGL03271:Unc80	APN	1	66695603	unclassified	probably benign
IGL03332:Unc80	APN	1	66503631	missense	probably damaging	1.00
IGL03347:Unc80	APN	1	66695466	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0026:Unc80	UTSW	1	66521584	missense	probably benign	0.27
R0055:Unc80	UTSW	1	66506623	splice site	probably benign
R0149:Unc80	UTSW	1	66521601	missense	possibly damaging	0.82
R0325:Unc80	UTSW	1	66510881	missense	probably damaging	1.00
R0329:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0330:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0412:Unc80	UTSW	1	66550937	splice site	probably benign
R0422:Unc80	UTSW	1	66483338	missense	probably damaging	1.00
R0477:Unc80	UTSW	1	66570001	missense	probably damaging	0.99
R0507:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0513:Unc80	UTSW	1	66622474	missense	possibly damaging	0.73
R0553:Unc80	UTSW	1	66506669	missense	probably damaging	0.97
R0626:Unc80	UTSW	1	66608442	missense	probably benign	0.01
R0655:Unc80	UTSW	1	66503781	missense	probably damaging	0.98
R0742:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0755:Unc80	UTSW	1	66504923	missense	probably damaging	1.00
R0782:Unc80	UTSW	1	66622581	missense	possibly damaging	0.53
R0837:Unc80	UTSW	1	66648944	missense	possibly damaging	0.73
R0841:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R0893:Unc80	UTSW	1	66521486	missense	probably damaging	0.97
R0900:Unc80	UTSW	1	66671598	missense	probably benign	0.33
R0924:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0930:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0989:Unc80	UTSW	1	66646440	missense	possibly damaging	0.53
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1224:Unc80	UTSW	1	66471980	missense	probably damaging	1.00
R1240:Unc80	UTSW	1	66635902	missense	possibly damaging	0.85
R1245:Unc80	UTSW	1	66555095	missense	possibly damaging	0.94
R1467:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1473:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1500:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1556:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1562:Unc80	UTSW	1	66637957	missense	probably damaging	1.00
R1655:Unc80	UTSW	1	66672756	missense	possibly damaging	0.86
R1674:Unc80	UTSW	1	66509308	missense	probably damaging	1.00
R1680:Unc80	UTSW	1	66503669	nonsense	probably null
R1739:Unc80	UTSW	1	66527892	missense	probably damaging	0.97
R1756:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1783:Unc80	UTSW	1	66683273	missense	probably benign	0.01
R1834:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1854:Unc80	UTSW	1	66631414	missense	possibly damaging	0.93
R1871:Unc80	UTSW	1	66510717	missense	possibly damaging	0.77
R1878:Unc80	UTSW	1	66509402	missense	probably damaging	0.96
R1883:Unc80	UTSW	1	66525770	missense	possibly damaging	0.89
R1912:Unc80	UTSW	1	66510625	missense	probably damaging	1.00
R1990:Unc80	UTSW	1	66692549	missense	probably damaging	0.97
R2007:Unc80	UTSW	1	66503776	missense	probably damaging	1.00
R2035:Unc80	UTSW	1	66606593	missense	probably damaging	0.98
R2056:Unc80	UTSW	1	66640552	missense	possibly damaging	0.72
R2060:Unc80	UTSW	1	66640595	missense	possibly damaging	0.53
R2074:Unc80	UTSW	1	66679744	critical splice donor site	probably null
R2088:Unc80	UTSW	1	66590227	missense	possibly damaging	0.77
R2089:Unc80	UTSW	1	66671715	splice site	probably benign
R2091:Unc80	UTSW	1	66671715	splice site	probably benign
R2139:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2169:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2175:Unc80	UTSW	1	66677355	missense	probably damaging	1.00
R2248:Unc80	UTSW	1	66623206	splice site	probably benign
R2255:Unc80	UTSW	1	66618258	missense	possibly damaging	0.53
R2308:Unc80	UTSW	1	66648997	missense	possibly damaging	0.53
R2484:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2507:Unc80	UTSW	1	66612107	missense	possibly damaging	0.53
R2512:Unc80	UTSW	1	66671608	missense	possibly damaging	0.70
R2878:Unc80	UTSW	1	66671576	critical splice acceptor site	probably benign
R3040:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3104:Unc80	UTSW	1	66623291	missense	probably benign	0.33
R3402:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3403:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3413:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3426:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3427:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3428:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3904:Unc80	UTSW	1	66639296	nonsense	probably null
R3916:Unc80	UTSW	1	66677495	missense	probably benign	0.11
R3950:Unc80	UTSW	1	66622570	missense	possibly damaging	0.53
R4642:Unc80	UTSW	1	66671714	splice site	probably null
R4646:Unc80	UTSW	1	66669235	missense	probably benign	0.03
R4655:Unc80	UTSW	1	66671662	missense	probably benign	0.18
R4662:Unc80	UTSW	1	66646436	missense	probably benign	0.01
R4720:Unc80	UTSW	1	66510792	missense	possibly damaging	0.92
R4736:Unc80	UTSW	1	66649672	critical splice acceptor site	probably null
R4795:Unc80	UTSW	1	66527941	missense	probably damaging	0.97
R4888:Unc80	UTSW	1	66644447	missense	probably damaging	0.98
R4917:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4918:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4983:Unc80	UTSW	1	66674732	splice site	probably null
R5051:Unc80	UTSW	1	66509477	missense	probably damaging	0.96
R5111:Unc80	UTSW	1	66527995	missense	possibly damaging	0.66
R5122:Unc80	UTSW	1	66679590	missense	possibly damaging	0.53
R5260:Unc80	UTSW	1	66646587	missense	possibly damaging	0.53
R5351:Unc80	UTSW	1	66606513	missense	possibly damaging	0.73
R5387:Unc80	UTSW	1	66530021	missense	possibly damaging	0.77
R5437:Unc80	UTSW	1	66654578	missense	possibly damaging	0.96
R5525:Unc80	UTSW	1	66606614	missense	possibly damaging	0.72
R5621:Unc80	UTSW	1	66638043	missense	possibly damaging	0.53
R5690:Unc80	UTSW	1	66640572	missense	probably benign	0.08
R5762:Unc80	UTSW	1	66693796	missense	possibly damaging	0.82
R5956:Unc80	UTSW	1	66527964	missense	probably damaging	0.97
R6005:Unc80	UTSW	1	66627257	missense	possibly damaging	0.53
R6025:Unc80	UTSW	1	66695568	missense	possibly damaging	0.90
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6117:Unc80	UTSW	1	66675067	missense	possibly damaging	0.72
R6156:Unc80	UTSW	1	66612250	missense	probably benign	0.01
R6157:Unc80	UTSW	1	66654029	nonsense	probably null
R6189:Unc80	UTSW	1	66677471	missense	probably benign	0.33
R6291:Unc80	UTSW	1	66521597	missense	possibly damaging	0.82
R6367:Unc80	UTSW	1	66672766	missense	probably benign	0.33
R6598:Unc80	UTSW	1	66468540	critical splice donor site	probably null
R6724:Unc80	UTSW	1	66683191	missense	possibly damaging	0.90
R6763:Unc80	UTSW	1	66521477	missense	probably benign	0.00
R6773:Unc80	UTSW	1	66651543	missense	probably benign	0.33
R6883:Unc80	UTSW	1	66646404	missense	probably benign	0.33
R6951:Unc80	UTSW	1	66648511	missense	possibly damaging	0.53
R6965:Unc80	UTSW	1	66646566	missense	probably benign	0.33
R6993:Unc80	UTSW	1	66549793	missense	possibly damaging	0.60
R7041:Unc80	UTSW	1	66503593	missense	probably benign	0.00
R7050:Unc80	UTSW	1	66550908	splice site	probably null
R7067:Unc80	UTSW	1	66646572	missense	possibly damaging	0.86
R7080:Unc80	UTSW	1	66646521	missense	possibly damaging	0.53
R7193:Unc80	UTSW	1	66549784	missense	possibly damaging	0.60
R7197:Unc80	UTSW	1	66521566	nonsense	probably null
R7278:Unc80	UTSW	1	66552209	missense	possibly damaging	0.82
R7290:Unc80	UTSW	1	66601197	missense	probably damaging	0.97
R7391:Unc80	UTSW	1	66695528	missense	probably benign	0.18
R7401:Unc80	UTSW	1	66646415	missense	possibly damaging	0.96
R7470:Unc80	UTSW	1	66622462	missense	probably benign	0.02
R7573:Unc80	UTSW	1	66521537	missense	probably damaging	1.00
R7637:Unc80	UTSW	1	66672684	missense	possibly damaging	0.86
R7678:Unc80	UTSW	1	66649722	missense	probably benign	0.33
R7697:Unc80	UTSW	1	66637945	missense	possibly damaging	0.93
R7746:Unc80	UTSW	1	66677385	missense	probably benign	0.33
R7768:Unc80	UTSW	1	66510595	missense	possibly damaging	0.56
R7796:Unc80	UTSW	1	66503714	missense	probably benign
R7855:Unc80	UTSW	1	66483349	missense	possibly damaging	0.78
R7878:Unc80	UTSW	1	66601141	missense	possibly damaging	0.88
R7879:Unc80	UTSW	1	66510707	missense	probably benign	0.00
R8024:Unc80	UTSW	1	66606644	missense	possibly damaging	0.86
R8026:Unc80	UTSW	1	66483304	missense	possibly damaging	0.92
R8115:Unc80	UTSW	1	66648913	missense	probably benign	0.00
R8135:Unc80	UTSW	1	66509287	missense	possibly damaging	0.49
R8170:Unc80	UTSW	1	66651533	missense	probably benign	0.33
R8239:Unc80	UTSW	1	66654019	missense	probably benign
R8249:Unc80	UTSW	1	66619491	missense	probably benign	0.01
R8275:Unc80	UTSW	1	66640614	nonsense	probably null
R8288:Unc80	UTSW	1	66473350	missense	probably benign	0.07
R8341:Unc80	UTSW	1	66649033	missense	possibly damaging	0.73
R8356:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8433:Unc80	UTSW	1	66638028	nonsense	probably null
R8456:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8464:Unc80	UTSW	1	66473264	missense	probably damaging	1.00
R8483:Unc80	UTSW	1	66693710	missense	possibly damaging	0.83
R8509:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8686:Unc80	UTSW	1	66612268	missense	possibly damaging	0.53
R8701:Unc80	UTSW	1	66638032	missense	possibly damaging	0.85
R8729:Unc80	UTSW	1	66608490	missense	probably benign	0.01
R8755:Unc80	UTSW	1	66612131	missense	possibly damaging	0.53
R8771:Unc80	UTSW	1	66646395	missense	possibly damaging	0.85
R8866:Unc80	UTSW	1	66590229	missense	probably benign	0.05
R8877:Unc80	UTSW	1	66527985	missense	possibly damaging	0.89
R8942:Unc80	UTSW	1	66473309	missense	possibly damaging	0.94
R8976:Unc80	UTSW	1	66472010	missense	possibly damaging	0.87
R9063:Unc80	UTSW	1	66606657	critical splice donor site	probably null
R9095:Unc80	UTSW	1	66506753	missense	probably damaging	1.00
R9125:Unc80	UTSW	1	66679581	missense	probably benign	0.18
R9130:Unc80	UTSW	1	66638085	missense	possibly damaging	0.85
R9165:Unc80	UTSW	1	66549841	missense	probably null	0.95
R9220:Unc80	UTSW	1	66507375	missense	probably damaging	1.00
R9262:Unc80	UTSW	1	66555252	intron	probably benign
R9334:Unc80	UTSW	1	66649760	missense	possibly damaging	0.73
R9374:Unc80	UTSW	1	66590301	missense	possibly damaging	0.95
R9387:Unc80	UTSW	1	66549938	critical splice donor site	probably null
R9415:Unc80	UTSW	1	66510905	missense
R9427:Unc80	UTSW	1	66554999	missense	probably damaging	1.00
R9436:Unc80	UTSW	1	66693805	critical splice donor site	probably null
R9454:Unc80	UTSW	1	66695590	missense	possibly damaging	0.53
R9522:Unc80	UTSW	1	66638062	missense	possibly damaging	0.73
R9539:Unc80	UTSW	1	66570004	critical splice donor site	probably null
R9552:Unc80	UTSW	1	66678123	missense	possibly damaging	0.85
R9667:Unc80	UTSW	1	66612128	missense	possibly damaging	0.86
R9720:Unc80	UTSW	1	66644326	missense	possibly damaging	0.53
R9749:Unc80	UTSW	1	66505020	missense	probably damaging	0.99
R9789:Unc80	UTSW	1	66612212	missense	possibly damaging	0.53
X0019:Unc80	UTSW	1	66648382	missense	probably benign	0.33
X0021:Unc80	UTSW	1	66509266	critical splice acceptor site	probably null
X0024:Unc80	UTSW	1	66491046	missense	probably benign	0.21
X0062:Unc80	UTSW	1	66623259	missense	probably benign	0.02
X0066:Unc80	UTSW	1	66530757	missense	possibly damaging	0.77
Y4335:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4336:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4338:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Z1088:Unc80	UTSW	1	66646451	missense	possibly damaging	0.85
Z1176:Unc80	UTSW	1	66694409	missense	probably benign
Z1177:Unc80	UTSW	1	66646398	missense	possibly damaging	0.72
Z1177:Unc80	UTSW	1	66695339	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGACATTTCACAAGAACCAGGGAC -3'
(R):5'- TGGAAGCATGAAGCCGTCATGTAG -3'

Sequencing Primer
(F):5'- GACTACTGAGACAGGGCTATTTCC -3'
(R):5'- CATGAAGCCGTCATGTAGATCTC -3'

Posted On

2013-04-24