Incidental Mutation 'R0355:Prmt8'
ID 29757
Institutional Source Beutler Lab
Gene Symbol Prmt8
Ensembl Gene ENSMUSG00000030350
Gene Name protein arginine N-methyltransferase 8
Synonyms Hrmt1l3, Hrmt1l4
MMRRC Submission 038561-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0355 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 127665972-127746430 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 127688837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 178 (K178*)
Ref Sequence ENSEMBL: ENSMUSP00000032500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032500]
AlphaFold Q6PAK3
Predicted Effect probably null
Transcript: ENSMUST00000032500
AA Change: K178*
SMART Domains Protein: ENSMUSP00000032500
Gene: ENSMUSG00000030350
AA Change: K178*

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:PRMT5 80 368 4.5e-7 PFAM
Pfam:PrmA 102 200 2e-10 PFAM
Pfam:Methyltransf_31 110 274 7.3e-9 PFAM
Pfam:Methyltransf_18 111 215 9.9e-8 PFAM
Pfam:Methyltransf_11 116 215 6.2e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit abnormal Purkinje cell dendrite morphology, hyperactivity, limb grasping and gait abnormalities, and show reduced levels of acetylcholine and choline along with increased phosphatidylcholine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,023,021 (GRCm39) I52M possibly damaging Het
Agbl5 G T 5: 31,049,335 (GRCm39) probably null Het
Akt2 T C 7: 27,336,334 (GRCm39) probably benign Het
Arl6ip5 T A 6: 97,209,378 (GRCm39) S138T probably damaging Het
Atp9b A G 18: 80,952,800 (GRCm39) probably benign Het
Ccdc171 A T 4: 83,553,919 (GRCm39) N422Y probably damaging Het
Ccr5 C T 9: 123,924,951 (GRCm39) P185S possibly damaging Het
Cep63 G T 9: 102,500,759 (GRCm39) Q38K probably benign Het
Cgn T C 3: 94,682,242 (GRCm39) S446G probably benign Het
Col16a1 T A 4: 129,952,206 (GRCm39) probably benign Het
Csmd1 T A 8: 15,968,330 (GRCm39) Q3099L probably damaging Het
Dcc G A 18: 71,708,279 (GRCm39) T479I possibly damaging Het
Dclre1a A G 19: 56,535,067 (GRCm39) probably null Het
Dlg1 T A 16: 31,502,992 (GRCm39) C66* probably null Het
Dnah12 T A 14: 26,427,272 (GRCm39) probably null Het
Dnajb9 T A 12: 44,253,987 (GRCm39) H140L probably damaging Het
Dnase1 G A 16: 3,857,413 (GRCm39) V237M probably damaging Het
Dscam C A 16: 96,456,105 (GRCm39) E1274D probably benign Het
Epb41 T C 4: 131,727,572 (GRCm39) H243R probably damaging Het
Evc T A 5: 37,473,656 (GRCm39) probably benign Het
Fcgrt T A 7: 44,752,493 (GRCm39) M1L unknown Het
Flii T C 11: 60,610,506 (GRCm39) probably null Het
Gen1 A G 12: 11,298,355 (GRCm39) probably benign Het
Gm10447 T C 11: 53,347,257 (GRCm39) probably benign Het
Gm57858 A G 3: 36,101,054 (GRCm39) probably benign Het
Gm8674 A T 13: 50,055,975 (GRCm39) noncoding transcript Het
Gpr137 G C 19: 6,916,491 (GRCm39) D253E probably damaging Het
Grid2ip A T 5: 143,343,652 (GRCm39) D116V probably benign Het
Grin2c A G 11: 115,151,554 (GRCm39) probably benign Het
Havcr1 A G 11: 46,647,051 (GRCm39) T162A possibly damaging Het
Hspa1l A T 17: 35,196,386 (GRCm39) T142S probably benign Het
Ift140 T A 17: 25,267,409 (GRCm39) Y602* probably null Het
Il18 T A 9: 50,490,575 (GRCm39) probably benign Het
Ilf3 T C 9: 21,309,266 (GRCm39) V474A probably damaging Het
Inppl1 T C 7: 101,476,664 (GRCm39) Y771C probably damaging Het
Ints2 T C 11: 86,125,575 (GRCm39) T542A probably benign Het
Ipo7 T C 7: 109,648,868 (GRCm39) Y714H probably benign Het
Itgbl1 T A 14: 124,077,997 (GRCm39) C162* probably null Het
Kcp T C 6: 29,496,926 (GRCm39) H561R possibly damaging Het
Krt23 G T 11: 99,376,613 (GRCm39) T181N probably benign Het
Lrrc40 A T 3: 157,746,108 (GRCm39) D61V probably damaging Het
Lypd4 T A 7: 24,564,691 (GRCm39) H149L probably benign Het
Map3k4 A G 17: 12,473,058 (GRCm39) F953L probably damaging Het
Mctp1 C T 13: 76,972,982 (GRCm39) P405S probably damaging Het
Mfsd2a G A 4: 122,845,632 (GRCm39) T173I possibly damaging Het
Mtus1 T C 8: 41,535,965 (GRCm39) T584A probably benign Het
Nell2 A G 15: 95,330,782 (GRCm39) V213A probably benign Het
Nipsnap1 G A 11: 4,839,957 (GRCm39) G226E probably damaging Het
Nudt15 T C 14: 73,760,824 (GRCm39) Y89C probably damaging Het
Or10g7 T A 9: 39,905,459 (GRCm39) S118T possibly damaging Het
Or10h28 T A 17: 33,488,109 (GRCm39) M137K probably damaging Het
Or13p3 T A 4: 118,566,808 (GRCm39) M68K probably benign Het
Or7a37 T G 10: 78,806,267 (GRCm39) S261R probably damaging Het
Phf24 A C 4: 42,933,891 (GRCm39) E91A probably damaging Het
Plbd1 T A 6: 136,618,165 (GRCm39) N17I possibly damaging Het
Por C T 5: 135,761,438 (GRCm39) S308L probably benign Het
Rev3l A G 10: 39,693,282 (GRCm39) N454S probably damaging Het
Rps6ka2 T C 17: 7,539,009 (GRCm39) V309A probably benign Het
Slc15a5 A G 6: 137,995,112 (GRCm39) probably benign Het
Slc30a6 G A 17: 74,730,198 (GRCm39) V363I probably benign Het
Snf8 G A 11: 95,930,125 (GRCm39) M42I probably benign Het
Stom T C 2: 35,215,371 (GRCm39) I65V probably benign Het
Tacr3 C T 3: 134,637,989 (GRCm39) T382I probably benign Het
Tenm3 A G 8: 48,682,010 (GRCm39) V2540A probably damaging Het
Trabd A G 15: 88,969,816 (GRCm39) T314A possibly damaging Het
Tyk2 T C 9: 21,025,486 (GRCm39) probably null Het
Ube4a T C 9: 44,856,099 (GRCm39) probably benign Het
Unc80 A G 1: 66,589,015 (GRCm39) H1060R possibly damaging Het
Virma A T 4: 11,528,626 (GRCm39) K1288* probably null Het
Vmn2r100 A C 17: 19,751,582 (GRCm39) I542L probably benign Het
Vwde T C 6: 13,187,806 (GRCm39) probably benign Het
Zfc3h1 T C 10: 115,245,018 (GRCm39) I797T possibly damaging Het
Zfp74 C T 7: 29,653,466 (GRCm39) probably benign Het
Zkscan7 T A 9: 122,717,872 (GRCm39) L89Q probably damaging Het
Other mutations in Prmt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Prmt8 APN 6 127,667,680 (GRCm39) missense probably benign 0.17
IGL02178:Prmt8 APN 6 127,674,770 (GRCm39) missense probably benign 0.06
IGL02526:Prmt8 APN 6 127,688,786 (GRCm39) missense probably damaging 0.96
IGL03010:Prmt8 APN 6 127,706,498 (GRCm39) missense probably benign 0.09
IGL03037:Prmt8 APN 6 127,680,940 (GRCm39) missense possibly damaging 0.75
R0096:Prmt8 UTSW 6 127,709,590 (GRCm39) splice site probably benign
R0254:Prmt8 UTSW 6 127,688,771 (GRCm39) missense probably damaging 1.00
R0925:Prmt8 UTSW 6 127,674,776 (GRCm39) missense probably benign 0.00
R1606:Prmt8 UTSW 6 127,666,799 (GRCm39) nonsense probably null
R1716:Prmt8 UTSW 6 127,703,486 (GRCm39) critical splice donor site probably null
R3789:Prmt8 UTSW 6 127,688,110 (GRCm39) missense probably damaging 1.00
R3790:Prmt8 UTSW 6 127,688,110 (GRCm39) missense probably damaging 1.00
R3958:Prmt8 UTSW 6 127,709,707 (GRCm39) missense probably benign 0.00
R5022:Prmt8 UTSW 6 127,688,126 (GRCm39) missense possibly damaging 0.92
R5143:Prmt8 UTSW 6 127,709,677 (GRCm39) missense probably benign
R5635:Prmt8 UTSW 6 127,745,692 (GRCm39) missense probably damaging 1.00
R5816:Prmt8 UTSW 6 127,674,701 (GRCm39) missense probably benign 0.09
R5959:Prmt8 UTSW 6 127,706,381 (GRCm39) missense probably damaging 1.00
R6267:Prmt8 UTSW 6 127,688,767 (GRCm39) missense probably damaging 0.99
R6296:Prmt8 UTSW 6 127,688,767 (GRCm39) missense probably damaging 0.99
R6450:Prmt8 UTSW 6 127,709,606 (GRCm39) missense possibly damaging 0.71
R6603:Prmt8 UTSW 6 127,706,376 (GRCm39) missense probably benign 0.00
R7208:Prmt8 UTSW 6 127,666,792 (GRCm39) missense possibly damaging 0.81
R7629:Prmt8 UTSW 6 127,666,846 (GRCm39) nonsense probably null
R7719:Prmt8 UTSW 6 127,706,466 (GRCm39) missense probably damaging 0.97
R8313:Prmt8 UTSW 6 127,666,813 (GRCm39) missense probably benign
R8346:Prmt8 UTSW 6 127,688,810 (GRCm39) missense probably damaging 1.00
R8404:Prmt8 UTSW 6 127,666,825 (GRCm39) missense possibly damaging 0.93
R8483:Prmt8 UTSW 6 127,680,976 (GRCm39) splice site probably null
R8843:Prmt8 UTSW 6 127,706,462 (GRCm39) missense probably damaging 0.99
X0020:Prmt8 UTSW 6 127,674,734 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACAGTTGGGTACAATTGGACCAGG -3'
(R):5'- GGATGTTACAGGCCCATTCCATCAG -3'

Sequencing Primer
(F):5'- AGAGACAGGTGATCCTCTAGCC -3'
(R):5'- tgtgagagaagatgataaggatagtg -3'
Posted On 2013-04-24