Incidental Mutation 'R0355:Prmt8'
ID29757
Institutional Source Beutler Lab
Gene Symbol Prmt8
Ensembl Gene ENSMUSG00000030350
Gene Nameprotein arginine N-methyltransferase 8
SynonymsHrmt1l3, Hrmt1l4
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location127689011-127769472 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 127711874 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 178 (K178*)
Ref Sequence ENSEMBL: ENSMUSP00000032500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032500]
Predicted Effect probably null
Transcript: ENSMUST00000032500
AA Change: K178*
SMART Domains Protein: ENSMUSP00000032500
Gene: ENSMUSG00000030350
AA Change: K178*

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:PRMT5 80 368 4.5e-7 PFAM
Pfam:PrmA 102 200 2e-10 PFAM
Pfam:Methyltransf_31 110 274 7.3e-9 PFAM
Pfam:Methyltransf_18 111 215 9.9e-8 PFAM
Pfam:Methyltransf_11 116 215 6.2e-8 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit abnormal Purkinje cell dendrite morphology, hyperactivity, limb grasping and gait abnormalities, and show reduced levels of acetylcholine and choline along with increased phosphatidylcholine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Prmt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Prmt8 APN 6 127690717 missense probably benign 0.17
IGL02178:Prmt8 APN 6 127697807 missense probably benign 0.06
IGL02526:Prmt8 APN 6 127711823 missense probably damaging 0.96
IGL03010:Prmt8 APN 6 127729535 missense probably benign 0.09
IGL03037:Prmt8 APN 6 127703977 missense possibly damaging 0.75
R0096:Prmt8 UTSW 6 127732627 splice site probably benign
R0254:Prmt8 UTSW 6 127711808 missense probably damaging 1.00
R0925:Prmt8 UTSW 6 127697813 missense probably benign 0.00
R1606:Prmt8 UTSW 6 127689836 nonsense probably null
R1716:Prmt8 UTSW 6 127726523 critical splice donor site probably null
R3789:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3790:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3958:Prmt8 UTSW 6 127732744 missense probably benign 0.00
R5022:Prmt8 UTSW 6 127711163 missense possibly damaging 0.92
R5143:Prmt8 UTSW 6 127732714 missense probably benign
R5635:Prmt8 UTSW 6 127768729 missense probably damaging 1.00
R5816:Prmt8 UTSW 6 127697738 missense probably benign 0.09
R5959:Prmt8 UTSW 6 127729418 missense probably damaging 1.00
R6267:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6296:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6450:Prmt8 UTSW 6 127732643 missense possibly damaging 0.71
R6603:Prmt8 UTSW 6 127729413 missense probably benign 0.00
R7208:Prmt8 UTSW 6 127689829 missense possibly damaging 0.81
R7629:Prmt8 UTSW 6 127689883 nonsense probably null
R7719:Prmt8 UTSW 6 127729503 missense probably damaging 0.97
X0020:Prmt8 UTSW 6 127697771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACAGTTGGGTACAATTGGACCAGG -3'
(R):5'- GGATGTTACAGGCCCATTCCATCAG -3'

Sequencing Primer
(F):5'- AGAGACAGGTGATCCTCTAGCC -3'
(R):5'- tgtgagagaagatgataaggatagtg -3'
Posted On2013-04-24