Incidental Mutation 'R0355:Inppl1'
ID29764
Institutional Source Beutler Lab
Gene Symbol Inppl1
Ensembl Gene ENSMUSG00000032737
Gene Nameinositol polyphosphate phosphatase-like 1
SynonymsSHIP2
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101822632-101838229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101827457 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 771 (Y771C)
Ref Sequence ENSEMBL: ENSMUSP00000139910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008090] [ENSMUST00000035836] [ENSMUST00000165052] [ENSMUST00000185929]
Predicted Effect probably benign
Transcript: ENSMUST00000008090
SMART Domains Protein: ENSMUSP00000008090
Gene: ENSMUSG00000007946

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
HOX 90 152 5.75e-27 SMART
low complexity region 183 223 N/A INTRINSIC
low complexity region 225 244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035836
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737
AA Change: Y771C

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165052
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737
AA Change: Y771C

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185929
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737
AA Change: Y771C

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186316
AA Change: Y190C
Predicted Effect unknown
Transcript: ENSMUST00000210116
AA Change: Y272C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211436
Meta Mutation Damage Score 0.9345 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice display decreased postnatal growth, decreased circulating levels of leptin, free fatty acids, triglycerides, and total cholesterol, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Inppl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Inppl1 APN 7 101829158 missense probably damaging 1.00
IGL01633:Inppl1 APN 7 101833834 nonsense probably null
IGL01678:Inppl1 APN 7 101832596 missense probably benign 0.09
IGL02420:Inppl1 APN 7 101832319 unclassified probably benign
IGL02423:Inppl1 APN 7 101832243 missense probably benign 0.02
IGL02965:Inppl1 APN 7 101828271 missense possibly damaging 0.87
IGL03329:Inppl1 APN 7 101824380 missense possibly damaging 0.48
PIT4362001:Inppl1 UTSW 7 101826013 missense probably benign 0.34
R0310:Inppl1 UTSW 7 101828499 splice site probably benign
R0394:Inppl1 UTSW 7 101828195 splice site probably benign
R0547:Inppl1 UTSW 7 101831003 missense probably benign 0.02
R0578:Inppl1 UTSW 7 101831588 missense probably damaging 1.00
R1506:Inppl1 UTSW 7 101823967 missense probably benign 0.01
R1526:Inppl1 UTSW 7 101832946 missense probably benign 0.02
R1901:Inppl1 UTSW 7 101823377 missense possibly damaging 0.85
R2381:Inppl1 UTSW 7 101829232 missense probably damaging 1.00
R3690:Inppl1 UTSW 7 101832068 missense probably damaging 0.99
R4911:Inppl1 UTSW 7 101832309 missense possibly damaging 0.94
R5637:Inppl1 UTSW 7 101828848 missense probably benign 0.08
R6227:Inppl1 UTSW 7 101824299 missense possibly damaging 0.88
R6409:Inppl1 UTSW 7 101828961 missense probably damaging 1.00
R6678:Inppl1 UTSW 7 101832270 missense probably damaging 0.99
R6752:Inppl1 UTSW 7 101832542 nonsense probably null
R7095:Inppl1 UTSW 7 101827456 nonsense probably null
R7196:Inppl1 UTSW 7 101828786 missense probably benign 0.05
R7421:Inppl1 UTSW 7 101832937 missense probably damaging 0.99
R7575:Inppl1 UTSW 7 101828482 missense probably damaging 1.00
R7664:Inppl1 UTSW 7 101830097 missense probably damaging 0.97
R7767:Inppl1 UTSW 7 101824338 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTGCTCTGAGCATCATTCTCGAAG -3'
(R):5'- AGAGACACTCTGGTCCTCACATCC -3'

Sequencing Primer
(F):5'- TCGAAGCTCTTCTTATACTCTGG -3'
(R):5'- caccagaagagggcatcag -3'
Posted On2013-04-24