Incidental Mutation 'R0355:Cep63'
ID29774
Institutional Source Beutler Lab
Gene Symbol Cep63
Ensembl Gene ENSMUSG00000032534
Gene Namecentrosomal protein 63
SynonymsD9Mgc48e, CD20R, D9Mgc41, ET2
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location102584588-102626534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102623560 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 38 (Q38K)
Ref Sequence ENSEMBL: ENSMUSP00000149157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038673] [ENSMUST00000093791] [ENSMUST00000159100] [ENSMUST00000161645] [ENSMUST00000162297] [ENSMUST00000162655] [ENSMUST00000186693] [ENSMUST00000188398] [ENSMUST00000190279] [ENSMUST00000213636] [ENSMUST00000216281]
Predicted Effect probably benign
Transcript: ENSMUST00000038673
SMART Domains Protein: ENSMUSP00000039761
Gene: ENSMUSG00000035048

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093791
AA Change: Q38K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534
AA Change: Q38K

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:CEP63 76 338 8.1e-112 PFAM
coiled coil region 401 469 N/A INTRINSIC
coiled coil region 492 591 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
coiled coil region 730 749 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159100
AA Change: Q38K
SMART Domains Protein: ENSMUSP00000124836
Gene: ENSMUSG00000032534
AA Change: Q38K

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161645
Predicted Effect probably benign
Transcript: ENSMUST00000162297
Predicted Effect probably benign
Transcript: ENSMUST00000162655
SMART Domains Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
coiled coil region 72 220 N/A INTRINSIC
coiled coil region 243 283 N/A INTRINSIC
coiled coil region 343 411 N/A INTRINSIC
coiled coil region 434 484 N/A INTRINSIC
coiled coil region 510 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162960
Predicted Effect probably benign
Transcript: ENSMUST00000186693
SMART Domains Protein: ENSMUSP00000139762
Gene: ENSMUSG00000035048

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188398
SMART Domains Protein: ENSMUSP00000140325
Gene: ENSMUSG00000035048

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190279
SMART Domains Protein: ENSMUSP00000140967
Gene: ENSMUSG00000035048

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190354
Predicted Effect probably benign
Transcript: ENSMUST00000213636
Predicted Effect probably benign
Transcript: ENSMUST00000215253
Predicted Effect probably benign
Transcript: ENSMUST00000216281
AA Change: Q38K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Cep63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Cep63 APN 9 102590458 missense possibly damaging 0.88
IGL02378:Cep63 APN 9 102596115 splice site probably benign
IGL02707:Cep63 APN 9 102586981 missense probably damaging 1.00
IGL03273:Cep63 APN 9 102602467 missense probably benign 0.13
R0847:Cep63 UTSW 9 102588758 missense probably benign 0.12
R1276:Cep63 UTSW 9 102588900 missense possibly damaging 0.77
R1398:Cep63 UTSW 9 102603086 splice site probably benign
R1654:Cep63 UTSW 9 102586913 missense possibly damaging 0.87
R1730:Cep63 UTSW 9 102618867 missense possibly damaging 0.93
R1982:Cep63 UTSW 9 102602880 missense probably damaging 0.99
R2359:Cep63 UTSW 9 102594564 missense possibly damaging 0.95
R2890:Cep63 UTSW 9 102618827 missense probably damaging 0.99
R3082:Cep63 UTSW 9 102602497 missense probably benign 0.00
R4725:Cep63 UTSW 9 102590556 intron probably benign
R4761:Cep63 UTSW 9 102587041 intron probably benign
R5200:Cep63 UTSW 9 102598188 missense probably benign 0.22
R5538:Cep63 UTSW 9 102588793 nonsense probably null
R6463:Cep63 UTSW 9 102596155 missense probably benign
R6887:Cep63 UTSW 9 102625927 intron probably benign
R7854:Cep63 UTSW 9 102602998 missense probably damaging 1.00
R7937:Cep63 UTSW 9 102602998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- cccagctaaagcaaaaCTAGGAGGAAA -3'
(R):5'- AGTCATCAGCCAGCCCTGACAT -3'

Sequencing Primer
(F):5'- agagatggctcagcgattaag -3'
(R):5'- aaattatctgttgcgttcattgtc -3'
Posted On2013-04-24