Mutagenetix > Incidental Mutation

Incidental Mutation 'R0355:Rev3l'

29777

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

038561-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39817286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 454 (N454S)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000164763]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000019986
AA Change: N454S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: N454S

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably damaging
Transcript: ENSMUST00000164763
AA Change: N454S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: N454S

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Meta Mutation Damage Score

0.0621

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 90.2%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	G	7: 120,423,798	I52M	possibly damaging	Het
Agbl5	G	T	5: 30,891,991		probably null	Het
Akt2	T	C	7: 27,636,909		probably benign	Het
Arl6ip5	T	A	6: 97,232,417	S138T	probably damaging	Het
Atp9b	A	G	18: 80,909,585		probably benign	Het
Ccdc144b	A	G	3: 36,046,905		probably benign	Het
Ccdc171	A	T	4: 83,635,682	N422Y	probably damaging	Het
Ccr5	C	T	9: 124,124,914	P185S	possibly damaging	Het
Cep63	G	T	9: 102,623,560	Q38K	probably benign	Het
Cgn	T	C	3: 94,774,932	S446G	probably benign	Het
Col16a1	T	A	4: 130,058,413		probably benign	Het
Csmd1	T	A	8: 15,918,330	Q3099L	probably damaging	Het
Dcc	G	A	18: 71,575,208	T479I	possibly damaging	Het
Dclre1a	A	G	19: 56,546,635		probably null	Het
Dlg1	T	A	16: 31,684,174	C66*	probably null	Het
Dnah12	T	A	14: 26,706,117		probably null	Het
Dnajb9	T	A	12: 44,207,204	H140L	probably damaging	Het
Dnase1	G	A	16: 4,039,549	V237M	probably damaging	Het
Dscam	C	A	16: 96,654,905	E1274D	probably benign	Het
Epb41	T	C	4: 132,000,261	H243R	probably damaging	Het
Evc	T	A	5: 37,316,312		probably benign	Het
Fcgrt	T	A	7: 45,103,069	M1L	unknown	Het
Flii	T	C	11: 60,719,680		probably null	Het
Gen1	A	G	12: 11,248,354		probably benign	Het
Gm10447	T	C	11: 53,456,430		probably benign	Het
Gm8674	A	T	13: 49,901,939		noncoding transcript	Het
Gpr137	G	C	19: 6,939,123	D253E	probably damaging	Het
Grid2ip	A	T	5: 143,357,897	D116V	probably benign	Het
Grin2c	A	G	11: 115,260,728		probably benign	Het
Havcr1	A	G	11: 46,756,224	T162A	possibly damaging	Het
Hspa1l	A	T	17: 34,977,410	T142S	probably benign	Het
Ift140	T	A	17: 25,048,435	Y602*	probably null	Het
Il18	T	A	9: 50,579,275		probably benign	Het
Ilf3	T	C	9: 21,397,970	V474A	probably damaging	Het
Inppl1	T	C	7: 101,827,457	Y771C	probably damaging	Het
Ints2	T	C	11: 86,234,749	T542A	probably benign	Het
Ipo7	T	C	7: 110,049,661	Y714H	probably benign	Het
Itgbl1	T	A	14: 123,840,585	C162*	probably null	Het
Kcp	T	C	6: 29,496,927	H561R	possibly damaging	Het
Krt23	G	T	11: 99,485,787	T181N	probably benign	Het
Lrrc40	A	T	3: 158,040,471	D61V	probably damaging	Het
Lypd4	T	A	7: 24,865,266	H149L	probably benign	Het
Map3k4	A	G	17: 12,254,171	F953L	probably damaging	Het
Mctp1	C	T	13: 76,824,863	P405S	probably damaging	Het
Mfsd2a	G	A	4: 122,951,839	T173I	possibly damaging	Het
Mtus1	T	C	8: 41,082,928	T584A	probably benign	Het
Nell2	A	G	15: 95,432,901	V213A	probably benign	Het
Nipsnap1	G	A	11: 4,889,957	G226E	probably damaging	Het
Nudt15	T	C	14: 73,523,384	Y89C	probably damaging	Het
Olfr1341	T	A	4: 118,709,611	M68K	probably benign	Het
Olfr1353	T	G	10: 78,970,433	S261R	probably damaging	Het
Olfr63	T	A	17: 33,269,135	M137K	probably damaging	Het
Olfr978	T	A	9: 39,994,163	S118T	possibly damaging	Het
Phf24	A	C	4: 42,933,891	E91A	probably damaging	Het
Plbd1	T	A	6: 136,641,167	N17I	possibly damaging	Het
Por	C	T	5: 135,732,584	S308L	probably benign	Het
Prmt8	T	A	6: 127,711,874	K178*	probably null	Het
Rps6ka2	T	C	17: 7,271,610	V309A	probably benign	Het
Slc15a5	A	G	6: 138,018,114		probably benign	Het
Slc30a6	G	A	17: 74,423,203	V363I	probably benign	Het
Snf8	G	A	11: 96,039,299	M42I	probably benign	Het
Stom	T	C	2: 35,325,359	I65V	probably benign	Het
Tacr3	C	T	3: 134,932,228	T382I	probably benign	Het
Tenm3	A	G	8: 48,228,975	V2540A	probably damaging	Het
Trabd	A	G	15: 89,085,613	T314A	possibly damaging	Het
Tyk2	T	C	9: 21,114,190		probably null	Het
Ube4a	T	C	9: 44,944,801		probably benign	Het
Unc80	A	G	1: 66,549,856	H1060R	possibly damaging	Het
Virma	A	T	4: 11,528,626	K1288*	probably null	Het
Vmn2r100	A	C	17: 19,531,320	I542L	probably benign	Het
Vwde	T	C	6: 13,187,807		probably benign	Het
Zfc3h1	T	C	10: 115,409,113	I797T	possibly damaging	Het
Zfp74	C	T	7: 29,954,041		probably benign	Het
Zkscan7	T	A	9: 122,888,807	L89Q	probably damaging	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
R9646:Rev3l	UTSW	10	39822444	missense	probably damaging	1.00
R9686:Rev3l	UTSW	10	39867388	missense	possibly damaging	0.67
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GGGAGCTACAGCATTAACACCTGAG -3'
(R):5'- TTTTAAGTGGACTCTGCACAGGGC -3'

Sequencing Primer
(F):5'- AGCATTAACACCTGAGCCTTTG -3'
(R):5'- ACTCTGCACAGGGCTACTTAG -3'

Posted On

2013-04-24