Incidental Mutation 'R0355:Havcr1'
ID 29781
Institutional Source Beutler Lab
Gene Symbol Havcr1
Ensembl Gene ENSMUSG00000040405
Gene Name hepatitis A virus cellular receptor 1
Synonyms KIM-1, Tim1, TIM-1
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0355 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 46735080-46779578 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46756224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 162 (T162A)
Ref Sequence ENSEMBL: ENSMUSP00000043827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047568] [ENSMUST00000081819] [ENSMUST00000109223] [ENSMUST00000109224]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047568
AA Change: T162A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043827
Gene: ENSMUSG00000040405
AA Change: T162A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081819
AA Change: T162A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080503
Gene: ENSMUSG00000040405
AA Change: T162A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109223
AA Change: T162A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104846
Gene: ENSMUSG00000040405
AA Change: T162A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
low complexity region 154 177 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109224
AA Change: T162A

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104847
Gene: ENSMUSG00000040405
AA Change: T162A

DomainStartEndE-ValueType
IG 22 128 4.82e-6 SMART
low complexity region 132 152 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to S. mansoni egg challenge. Mice homozygous for an allele lacking the mucin domain display impaired regulatory B cell function and systemic autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Havcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Havcr1 APN 11 46775493 missense probably damaging 1.00
IGL02207:Havcr1 APN 11 46778576 missense probably benign 0.28
R0371:Havcr1 UTSW 11 46752589 missense possibly damaging 0.95
R0488:Havcr1 UTSW 11 46752571 missense probably damaging 1.00
R0883:Havcr1 UTSW 11 46752432 missense probably damaging 1.00
R1307:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1308:Havcr1 UTSW 11 46756270 missense probably damaging 0.99
R1554:Havcr1 UTSW 11 46752507 missense probably benign
R1908:Havcr1 UTSW 11 46773684 nonsense probably null
R2165:Havcr1 UTSW 11 46778552 missense probably benign 0.14
R3085:Havcr1 UTSW 11 46756225 missense probably damaging 0.99
R3757:Havcr1 UTSW 11 46752580 missense probably damaging 1.00
R4719:Havcr1 UTSW 11 46752441 missense probably benign 0.02
R5191:Havcr1 UTSW 11 46756197 missense probably benign 0.40
R5440:Havcr1 UTSW 11 46752370 missense probably damaging 1.00
R5710:Havcr1 UTSW 11 46752526 missense probably damaging 1.00
R5988:Havcr1 UTSW 11 46756137 missense probably damaging 1.00
R7570:Havcr1 UTSW 11 46770542 critical splice donor site probably null
R7962:Havcr1 UTSW 11 46752575 nonsense probably null
R8953:Havcr1 UTSW 11 46756179 missense possibly damaging 0.91
R9259:Havcr1 UTSW 11 46770491 missense probably damaging 1.00
R9424:Havcr1 UTSW 11 46778564 missense probably benign
R9576:Havcr1 UTSW 11 46778564 missense probably benign
Z1177:Havcr1 UTSW 11 46775498 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTCGAAGCTCTTGTCACTTCTTGC -3'
(R):5'- AGTGGCCCTGGTTCTCAGTCATTC -3'

Sequencing Primer
(F):5'- TGCCTGACTCATCCTTGC -3'
(R):5'- CAACCGTGTGTGAATACAGCTTG -3'
Posted On 2013-04-24