Incidental Mutation 'R0355:Dnajb9'
ID 29787
Institutional Source Beutler Lab
Gene Symbol Dnajb9
Ensembl Gene ENSMUSG00000014905
Gene Name DnaJ heat shock protein family (Hsp40) member B9
Synonyms ERdj4, Mdg1, mDj7, microvascular endothelial differentiation gene
MMRRC Submission 038561-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.446) question?
Stock # R0355 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 44252680-44256851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44253987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 140 (H140L)
Ref Sequence ENSEMBL: ENSMUSP00000015049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015049] [ENSMUST00000220421]
AlphaFold Q9QYI6
Predicted Effect probably damaging
Transcript: ENSMUST00000015049
AA Change: H140L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015049
Gene: ENSMUSG00000014905
AA Change: H140L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
DnaJ 25 82 2.55e-29 SMART
low complexity region 111 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219471
Predicted Effect probably benign
Transcript: ENSMUST00000220421
Meta Mutation Damage Score 0.1143 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele show perinatal death, reduced birth size and liver glycogen levels, and hypoglycemia. Surviving adults show elevated ER stress in MEFs, lung, kidney, salivary gland and in pancreas, associated with beta cell loss, hypoinsulinemia, and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,023,021 (GRCm39) I52M possibly damaging Het
Agbl5 G T 5: 31,049,335 (GRCm39) probably null Het
Akt2 T C 7: 27,336,334 (GRCm39) probably benign Het
Arl6ip5 T A 6: 97,209,378 (GRCm39) S138T probably damaging Het
Atp9b A G 18: 80,952,800 (GRCm39) probably benign Het
Ccdc171 A T 4: 83,553,919 (GRCm39) N422Y probably damaging Het
Ccr5 C T 9: 123,924,951 (GRCm39) P185S possibly damaging Het
Cep63 G T 9: 102,500,759 (GRCm39) Q38K probably benign Het
Cgn T C 3: 94,682,242 (GRCm39) S446G probably benign Het
Col16a1 T A 4: 129,952,206 (GRCm39) probably benign Het
Csmd1 T A 8: 15,968,330 (GRCm39) Q3099L probably damaging Het
Dcc G A 18: 71,708,279 (GRCm39) T479I possibly damaging Het
Dclre1a A G 19: 56,535,067 (GRCm39) probably null Het
Dlg1 T A 16: 31,502,992 (GRCm39) C66* probably null Het
Dnah12 T A 14: 26,427,272 (GRCm39) probably null Het
Dnase1 G A 16: 3,857,413 (GRCm39) V237M probably damaging Het
Dscam C A 16: 96,456,105 (GRCm39) E1274D probably benign Het
Epb41 T C 4: 131,727,572 (GRCm39) H243R probably damaging Het
Evc T A 5: 37,473,656 (GRCm39) probably benign Het
Fcgrt T A 7: 44,752,493 (GRCm39) M1L unknown Het
Flii T C 11: 60,610,506 (GRCm39) probably null Het
Gen1 A G 12: 11,298,355 (GRCm39) probably benign Het
Gm10447 T C 11: 53,347,257 (GRCm39) probably benign Het
Gm57858 A G 3: 36,101,054 (GRCm39) probably benign Het
Gm8674 A T 13: 50,055,975 (GRCm39) noncoding transcript Het
Gpr137 G C 19: 6,916,491 (GRCm39) D253E probably damaging Het
Grid2ip A T 5: 143,343,652 (GRCm39) D116V probably benign Het
Grin2c A G 11: 115,151,554 (GRCm39) probably benign Het
Havcr1 A G 11: 46,647,051 (GRCm39) T162A possibly damaging Het
Hspa1l A T 17: 35,196,386 (GRCm39) T142S probably benign Het
Ift140 T A 17: 25,267,409 (GRCm39) Y602* probably null Het
Il18 T A 9: 50,490,575 (GRCm39) probably benign Het
Ilf3 T C 9: 21,309,266 (GRCm39) V474A probably damaging Het
Inppl1 T C 7: 101,476,664 (GRCm39) Y771C probably damaging Het
Ints2 T C 11: 86,125,575 (GRCm39) T542A probably benign Het
Ipo7 T C 7: 109,648,868 (GRCm39) Y714H probably benign Het
Itgbl1 T A 14: 124,077,997 (GRCm39) C162* probably null Het
Kcp T C 6: 29,496,926 (GRCm39) H561R possibly damaging Het
Krt23 G T 11: 99,376,613 (GRCm39) T181N probably benign Het
Lrrc40 A T 3: 157,746,108 (GRCm39) D61V probably damaging Het
Lypd4 T A 7: 24,564,691 (GRCm39) H149L probably benign Het
Map3k4 A G 17: 12,473,058 (GRCm39) F953L probably damaging Het
Mctp1 C T 13: 76,972,982 (GRCm39) P405S probably damaging Het
Mfsd2a G A 4: 122,845,632 (GRCm39) T173I possibly damaging Het
Mtus1 T C 8: 41,535,965 (GRCm39) T584A probably benign Het
Nell2 A G 15: 95,330,782 (GRCm39) V213A probably benign Het
Nipsnap1 G A 11: 4,839,957 (GRCm39) G226E probably damaging Het
Nudt15 T C 14: 73,760,824 (GRCm39) Y89C probably damaging Het
Or10g7 T A 9: 39,905,459 (GRCm39) S118T possibly damaging Het
Or10h28 T A 17: 33,488,109 (GRCm39) M137K probably damaging Het
Or13p3 T A 4: 118,566,808 (GRCm39) M68K probably benign Het
Or7a37 T G 10: 78,806,267 (GRCm39) S261R probably damaging Het
Phf24 A C 4: 42,933,891 (GRCm39) E91A probably damaging Het
Plbd1 T A 6: 136,618,165 (GRCm39) N17I possibly damaging Het
Por C T 5: 135,761,438 (GRCm39) S308L probably benign Het
Prmt8 T A 6: 127,688,837 (GRCm39) K178* probably null Het
Rev3l A G 10: 39,693,282 (GRCm39) N454S probably damaging Het
Rps6ka2 T C 17: 7,539,009 (GRCm39) V309A probably benign Het
Slc15a5 A G 6: 137,995,112 (GRCm39) probably benign Het
Slc30a6 G A 17: 74,730,198 (GRCm39) V363I probably benign Het
Snf8 G A 11: 95,930,125 (GRCm39) M42I probably benign Het
Stom T C 2: 35,215,371 (GRCm39) I65V probably benign Het
Tacr3 C T 3: 134,637,989 (GRCm39) T382I probably benign Het
Tenm3 A G 8: 48,682,010 (GRCm39) V2540A probably damaging Het
Trabd A G 15: 88,969,816 (GRCm39) T314A possibly damaging Het
Tyk2 T C 9: 21,025,486 (GRCm39) probably null Het
Ube4a T C 9: 44,856,099 (GRCm39) probably benign Het
Unc80 A G 1: 66,589,015 (GRCm39) H1060R possibly damaging Het
Virma A T 4: 11,528,626 (GRCm39) K1288* probably null Het
Vmn2r100 A C 17: 19,751,582 (GRCm39) I542L probably benign Het
Vwde T C 6: 13,187,806 (GRCm39) probably benign Het
Zfc3h1 T C 10: 115,245,018 (GRCm39) I797T possibly damaging Het
Zfp74 C T 7: 29,653,466 (GRCm39) probably benign Het
Zkscan7 T A 9: 122,717,872 (GRCm39) L89Q probably damaging Het
Other mutations in Dnajb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb9 APN 12 44,253,869 (GRCm39) missense possibly damaging 0.72
IGL02093:Dnajb9 APN 12 44,253,987 (GRCm39) missense probably damaging 0.99
IGL03383:Dnajb9 APN 12 44,255,096 (GRCm39) splice site probably benign
R0595:Dnajb9 UTSW 12 44,255,067 (GRCm39) missense probably benign 0.00
R2191:Dnajb9 UTSW 12 44,253,856 (GRCm39) missense probably benign
R4192:Dnajb9 UTSW 12 44,253,860 (GRCm39) missense probably benign 0.01
R7574:Dnajb9 UTSW 12 44,254,169 (GRCm39) missense probably damaging 1.00
R8213:Dnajb9 UTSW 12 44,253,916 (GRCm39) missense probably benign 0.18
X0067:Dnajb9 UTSW 12 44,254,116 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTCTTCGTTGAGTGACAGTCCTGC -3'
(R):5'- CTCTCGGATGCCAATAGTCGGAAAG -3'

Sequencing Primer
(F):5'- CAGTGCTTGCTAGATCCATGAAATC -3'
(R):5'- CCAATAGTCGGAAAGAGTATGACAC -3'
Posted On 2013-04-24