Incidental Mutation 'R0355:Dnajb9'
ID29787
Institutional Source Beutler Lab
Gene Symbol Dnajb9
Ensembl Gene ENSMUSG00000014905
Gene NameDnaJ heat shock protein family (Hsp40) member B9
SynonymsmDj7, Mdg1, microvascular endothelial differentiation gene, ERdj4
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location44205559-44210326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44207204 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 140 (H140L)
Ref Sequence ENSEMBL: ENSMUSP00000015049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015049] [ENSMUST00000220421]
Predicted Effect probably damaging
Transcript: ENSMUST00000015049
AA Change: H140L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015049
Gene: ENSMUSG00000014905
AA Change: H140L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
DnaJ 25 82 2.55e-29 SMART
low complexity region 111 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219471
Predicted Effect probably benign
Transcript: ENSMUST00000220421
Meta Mutation Damage Score 0.1143 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele show perinatal death, reduced birth size and liver glycogen levels, and hypoglycemia. Surviving adults show elevated ER stress in MEFs, lung, kidney, salivary gland and in pancreas, associated with beta cell loss, hypoinsulinemia, and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Dnajb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb9 APN 12 44207086 missense possibly damaging 0.72
IGL02093:Dnajb9 APN 12 44207204 missense probably damaging 0.99
IGL03383:Dnajb9 APN 12 44208313 splice site probably benign
R0595:Dnajb9 UTSW 12 44208284 missense probably benign 0.00
R2191:Dnajb9 UTSW 12 44207073 missense probably benign
R4192:Dnajb9 UTSW 12 44207077 missense probably benign 0.01
R7574:Dnajb9 UTSW 12 44207386 missense probably damaging 1.00
X0067:Dnajb9 UTSW 12 44207333 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTCTTCGTTGAGTGACAGTCCTGC -3'
(R):5'- CTCTCGGATGCCAATAGTCGGAAAG -3'

Sequencing Primer
(F):5'- CAGTGCTTGCTAGATCCATGAAATC -3'
(R):5'- CCAATAGTCGGAAAGAGTATGACAC -3'
Posted On2013-04-24