Incidental Mutation 'R0355:Dnase1'
ID29794
Institutional Source Beutler Lab
Gene Symbol Dnase1
Ensembl Gene ENSMUSG00000005980
Gene Namedeoxyribonuclease I
SynonymsDNaseI, Dnl1
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4036942-4040024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4039549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 237 (V237M)
Ref Sequence ENSEMBL: ENSMUSP00000113119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000137748] [ENSMUST00000157044] [ENSMUST00000175755] [ENSMUST00000177337]
Predicted Effect probably damaging
Transcript: ENSMUST00000006136
AA Change: V237M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980
AA Change: V237M

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120009
AA Change: V237M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980
AA Change: V237M

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132466
Predicted Effect probably benign
Transcript: ENSMUST00000137748
SMART Domains Protein: ENSMUSP00000119934
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 225 7.51e-146 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150906
Predicted Effect probably benign
Transcript: ENSMUST00000157044
SMART Domains Protein: ENSMUSP00000120642
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 70 4.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176642
Predicted Effect probably benign
Transcript: ENSMUST00000177337
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Meta Mutation Damage Score 0.7840 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Some heterozygote and homozygote null mice have autoimmune symptoms similar to systemic lupus erythematosus. These include enlarged lymph nodes, circulating auto-antibodies, kidney inflammation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Dnase1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Dnase1 APN 16 4039024 missense probably damaging 1.00
IGL00896:Dnase1 APN 16 4039212 missense probably benign 0.00
IGL00983:Dnase1 APN 16 4039553 missense possibly damaging 0.70
IGL02186:Dnase1 APN 16 4039032 missense probably benign 0.18
IGL03373:Dnase1 APN 16 4039843 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0009:Dnase1 UTSW 16 4038946 missense probably damaging 1.00
R0467:Dnase1 UTSW 16 4039149 missense probably damaging 1.00
R4964:Dnase1 UTSW 16 4037907 intron probably benign
R4966:Dnase1 UTSW 16 4037907 intron probably benign
R5014:Dnase1 UTSW 16 4039016 nonsense probably null
R5621:Dnase1 UTSW 16 4039118 missense probably benign 0.01
R5858:Dnase1 UTSW 16 4039649 splice site probably benign
R6256:Dnase1 UTSW 16 4037621 missense probably benign 0.06
R6519:Dnase1 UTSW 16 4038589 missense probably damaging 1.00
R7002:Dnase1 UTSW 16 4039546 missense possibly damaging 0.76
R8050:Dnase1 UTSW 16 4037997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGACAGGTGAGCAGCCCCAAAG -3'
(R):5'- ACTGCCTCCACCCACATCTAGTATG -3'

Sequencing Primer
(F):5'- TTCTCCTACTCAAGAGGCAGG -3'
(R):5'- ATGGAAACAGTAGCTCCTGCTTG -3'
Posted On2013-04-24