Mutagenetix > Incidental Mutation

Incidental Mutation 'R0355:Ift140'

29799

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

038561-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0355 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 25048435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 602 (Y602*)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably null
Transcript: ENSMUST00000024983
AA Change: Y602*

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: Y602*

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000137386
AA Change: Y602*

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: Y602*

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 90.2%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	T	G	7: 120,423,798	I52M	possibly damaging	Het
Agbl5	G	T	5: 30,891,991		probably null	Het
Akt2	T	C	7: 27,636,909		probably benign	Het
Arl6ip5	T	A	6: 97,232,417	S138T	probably damaging	Het
Atp9b	A	G	18: 80,909,585		probably benign	Het
Ccdc144b	A	G	3: 36,046,905		probably benign	Het
Ccdc171	A	T	4: 83,635,682	N422Y	probably damaging	Het
Ccr5	C	T	9: 124,124,914	P185S	possibly damaging	Het
Cep63	G	T	9: 102,623,560	Q38K	probably benign	Het
Cgn	T	C	3: 94,774,932	S446G	probably benign	Het
Col16a1	T	A	4: 130,058,413		probably benign	Het
Csmd1	T	A	8: 15,918,330	Q3099L	probably damaging	Het
Dcc	G	A	18: 71,575,208	T479I	possibly damaging	Het
Dclre1a	A	G	19: 56,546,635		probably null	Het
Dlg1	T	A	16: 31,684,174	C66*	probably null	Het
Dnah12	T	A	14: 26,706,117		probably null	Het
Dnajb9	T	A	12: 44,207,204	H140L	probably damaging	Het
Dnase1	G	A	16: 4,039,549	V237M	probably damaging	Het
Dscam	C	A	16: 96,654,905	E1274D	probably benign	Het
Epb41	T	C	4: 132,000,261	H243R	probably damaging	Het
Evc	T	A	5: 37,316,312		probably benign	Het
Fcgrt	T	A	7: 45,103,069	M1L	unknown	Het
Flii	T	C	11: 60,719,680		probably null	Het
Gen1	A	G	12: 11,248,354		probably benign	Het
Gm10447	T	C	11: 53,456,430		probably benign	Het
Gm8674	A	T	13: 49,901,939		noncoding transcript	Het
Gpr137	G	C	19: 6,939,123	D253E	probably damaging	Het
Grid2ip	A	T	5: 143,357,897	D116V	probably benign	Het
Grin2c	A	G	11: 115,260,728		probably benign	Het
Havcr1	A	G	11: 46,756,224	T162A	possibly damaging	Het
Hspa1l	A	T	17: 34,977,410	T142S	probably benign	Het
Il18	T	A	9: 50,579,275		probably benign	Het
Ilf3	T	C	9: 21,397,970	V474A	probably damaging	Het
Inppl1	T	C	7: 101,827,457	Y771C	probably damaging	Het
Ints2	T	C	11: 86,234,749	T542A	probably benign	Het
Ipo7	T	C	7: 110,049,661	Y714H	probably benign	Het
Itgbl1	T	A	14: 123,840,585	C162*	probably null	Het
Kcp	T	C	6: 29,496,927	H561R	possibly damaging	Het
Krt23	G	T	11: 99,485,787	T181N	probably benign	Het
Lrrc40	A	T	3: 158,040,471	D61V	probably damaging	Het
Lypd4	T	A	7: 24,865,266	H149L	probably benign	Het
Map3k4	A	G	17: 12,254,171	F953L	probably damaging	Het
Mctp1	C	T	13: 76,824,863	P405S	probably damaging	Het
Mfsd2a	G	A	4: 122,951,839	T173I	possibly damaging	Het
Mtus1	T	C	8: 41,082,928	T584A	probably benign	Het
Nell2	A	G	15: 95,432,901	V213A	probably benign	Het
Nipsnap1	G	A	11: 4,889,957	G226E	probably damaging	Het
Nudt15	T	C	14: 73,523,384	Y89C	probably damaging	Het
Olfr1341	T	A	4: 118,709,611	M68K	probably benign	Het
Olfr1353	T	G	10: 78,970,433	S261R	probably damaging	Het
Olfr63	T	A	17: 33,269,135	M137K	probably damaging	Het
Olfr978	T	A	9: 39,994,163	S118T	possibly damaging	Het
Phf24	A	C	4: 42,933,891	E91A	probably damaging	Het
Plbd1	T	A	6: 136,641,167	N17I	possibly damaging	Het
Por	C	T	5: 135,732,584	S308L	probably benign	Het
Prmt8	T	A	6: 127,711,874	K178*	probably null	Het
Rev3l	A	G	10: 39,817,286	N454S	probably damaging	Het
Rps6ka2	T	C	17: 7,271,610	V309A	probably benign	Het
Slc15a5	A	G	6: 138,018,114		probably benign	Het
Slc30a6	G	A	17: 74,423,203	V363I	probably benign	Het
Snf8	G	A	11: 96,039,299	M42I	probably benign	Het
Stom	T	C	2: 35,325,359	I65V	probably benign	Het
Tacr3	C	T	3: 134,932,228	T382I	probably benign	Het
Tenm3	A	G	8: 48,228,975	V2540A	probably damaging	Het
Trabd	A	G	15: 89,085,613	T314A	possibly damaging	Het
Tyk2	T	C	9: 21,114,190		probably null	Het
Ube4a	T	C	9: 44,944,801		probably benign	Het
Unc80	A	G	1: 66,549,856	H1060R	possibly damaging	Het
Virma	A	T	4: 11,528,626	K1288*	probably null	Het
Vmn2r100	A	C	17: 19,531,320	I542L	probably benign	Het
Vwde	T	C	6: 13,187,807		probably benign	Het
Zfc3h1	T	C	10: 115,409,113	I797T	possibly damaging	Het
Zfp74	C	T	7: 29,954,041		probably benign	Het
Zkscan7	T	A	9: 122,888,807	L89Q	probably damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03
R9782:Ift140	UTSW	17	25045177	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGGAGCAATCATCATCCGCATC -3'
(R):5'- AGCGGCTCACACCTTGGTTTTAC -3'

Sequencing Primer
(F):5'- caggaggcaggggcaag -3'
(R):5'- TTGTTTTCCTACTTAGTAACTTCTGG -3'

Posted On

2013-04-24