Incidental Mutation 'R0355:Olfr63'
ID29800
Institutional Source Beutler Lab
Gene Symbol Olfr63
Ensembl Gene ENSMUSG00000054666
Gene Nameolfactory receptor 63
SynonymsGA_x6K02T2NTC5-9778-8828, M4, MOR267-1
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33264676-33275644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33269135 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 137 (M137K)
Ref Sequence ENSEMBL: ENSMUSP00000150323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067840] [ENSMUST00000217023]
Predicted Effect probably damaging
Transcript: ENSMUST00000067840
AA Change: M137K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067207
Gene: ENSMUSG00000054666
AA Change: M137K

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7tm_1 42 288 5.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215466
Predicted Effect probably damaging
Transcript: ENSMUST00000217023
AA Change: M137K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.4719 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Slc30a6 G A 17: 74,423,203 V363I probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Olfr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Olfr63 APN 17 33269655 missense probably benign 0.00
IGL02313:Olfr63 APN 17 33269665 missense probably benign
IGL02639:Olfr63 APN 17 33269395 missense possibly damaging 0.96
IGL02851:Olfr63 APN 17 33269354 missense probably benign 0.01
IGL03007:Olfr63 APN 17 33268883 missense probably damaging 0.98
IGL03206:Olfr63 APN 17 33268751 missense possibly damaging 0.46
R0143:Olfr63 UTSW 17 33269497 missense probably damaging 1.00
R1115:Olfr63 UTSW 17 33268966 nonsense probably null
R1117:Olfr63 UTSW 17 33268966 nonsense probably null
R1567:Olfr63 UTSW 17 33269476 missense probably benign
R1986:Olfr63 UTSW 17 33269515 missense probably benign 0.00
R3905:Olfr63 UTSW 17 33268775 missense probably damaging 1.00
R4612:Olfr63 UTSW 17 33269480 missense probably benign 0.20
R5650:Olfr63 UTSW 17 33268884 missense probably benign 0.05
R5855:Olfr63 UTSW 17 33269336 missense possibly damaging 0.81
R6712:Olfr63 UTSW 17 33269268 missense possibly damaging 0.76
R7873:Olfr63 UTSW 17 33269374 missense probably benign
X0026:Olfr63 UTSW 17 33269050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGTCATCATGGCTGCTATCTG -3'
(R):5'- TGACAAAGGCTGTCCTTTCCCCAC -3'

Sequencing Primer
(F):5'- TGGCTGCTATCTGGACAGAAC -3'
(R):5'- TTTCCCCACAGGCTAACTTTAAGAG -3'
Posted On2013-04-24