Incidental Mutation 'R0355:Slc30a6'
ID29802
Institutional Source Beutler Lab
Gene Symbol Slc30a6
Ensembl Gene ENSMUSG00000024069
Gene Namesolute carrier family 30 (zinc transporter), member 6
SynonymsZnT6, ZnT-6
MMRRC Submission 038561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R0355 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74395608-74424229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74423203 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 363 (V363I)
Ref Sequence ENSEMBL: ENSMUSP00000136503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024870] [ENSMUST00000052124] [ENSMUST00000179074]
Predicted Effect probably benign
Transcript: ENSMUST00000024870
AA Change: V358I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024870
Gene: ENSMUSG00000024069
AA Change: V358I

DomainStartEndE-ValueType
Pfam:Cation_efflux 34 336 6.9e-45 PFAM
low complexity region 371 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052124
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179074
AA Change: V363I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136503
Gene: ENSMUSG00000024069
AA Change: V363I

DomainStartEndE-ValueType
Pfam:Cation_efflux 34 260 5.7e-30 PFAM
low complexity region 376 397 N/A INTRINSIC
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function as zinc transporters. This protein can regulate subcellular levels of zinc in the Golgi and vesicles. Expression of this gene is altered in the Alzheimer's disease brain plaques. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T G 7: 120,423,798 I52M possibly damaging Het
Agbl5 G T 5: 30,891,991 probably null Het
Akt2 T C 7: 27,636,909 probably benign Het
Arl6ip5 T A 6: 97,232,417 S138T probably damaging Het
Atp9b A G 18: 80,909,585 probably benign Het
Ccdc144b A G 3: 36,046,905 probably benign Het
Ccdc171 A T 4: 83,635,682 N422Y probably damaging Het
Ccr5 C T 9: 124,124,914 P185S possibly damaging Het
Cep63 G T 9: 102,623,560 Q38K probably benign Het
Cgn T C 3: 94,774,932 S446G probably benign Het
Col16a1 T A 4: 130,058,413 probably benign Het
Csmd1 T A 8: 15,918,330 Q3099L probably damaging Het
Dcc G A 18: 71,575,208 T479I possibly damaging Het
Dclre1a A G 19: 56,546,635 probably null Het
Dlg1 T A 16: 31,684,174 C66* probably null Het
Dnah12 T A 14: 26,706,117 probably null Het
Dnajb9 T A 12: 44,207,204 H140L probably damaging Het
Dnase1 G A 16: 4,039,549 V237M probably damaging Het
Dscam C A 16: 96,654,905 E1274D probably benign Het
Epb41 T C 4: 132,000,261 H243R probably damaging Het
Evc T A 5: 37,316,312 probably benign Het
Fcgrt T A 7: 45,103,069 M1L unknown Het
Flii T C 11: 60,719,680 probably null Het
Gen1 A G 12: 11,248,354 probably benign Het
Gm10447 T C 11: 53,456,430 probably benign Het
Gm8674 A T 13: 49,901,939 noncoding transcript Het
Gpr137 G C 19: 6,939,123 D253E probably damaging Het
Grid2ip A T 5: 143,357,897 D116V probably benign Het
Grin2c A G 11: 115,260,728 probably benign Het
Havcr1 A G 11: 46,756,224 T162A possibly damaging Het
Hspa1l A T 17: 34,977,410 T142S probably benign Het
Ift140 T A 17: 25,048,435 Y602* probably null Het
Il18 T A 9: 50,579,275 probably benign Het
Ilf3 T C 9: 21,397,970 V474A probably damaging Het
Inppl1 T C 7: 101,827,457 Y771C probably damaging Het
Ints2 T C 11: 86,234,749 T542A probably benign Het
Ipo7 T C 7: 110,049,661 Y714H probably benign Het
Itgbl1 T A 14: 123,840,585 C162* probably null Het
Kcp T C 6: 29,496,927 H561R possibly damaging Het
Krt23 G T 11: 99,485,787 T181N probably benign Het
Lrrc40 A T 3: 158,040,471 D61V probably damaging Het
Lypd4 T A 7: 24,865,266 H149L probably benign Het
Map3k4 A G 17: 12,254,171 F953L probably damaging Het
Mctp1 C T 13: 76,824,863 P405S probably damaging Het
Mfsd2a G A 4: 122,951,839 T173I possibly damaging Het
Mtus1 T C 8: 41,082,928 T584A probably benign Het
Nell2 A G 15: 95,432,901 V213A probably benign Het
Nipsnap1 G A 11: 4,889,957 G226E probably damaging Het
Nudt15 T C 14: 73,523,384 Y89C probably damaging Het
Olfr1341 T A 4: 118,709,611 M68K probably benign Het
Olfr1353 T G 10: 78,970,433 S261R probably damaging Het
Olfr63 T A 17: 33,269,135 M137K probably damaging Het
Olfr978 T A 9: 39,994,163 S118T possibly damaging Het
Phf24 A C 4: 42,933,891 E91A probably damaging Het
Plbd1 T A 6: 136,641,167 N17I possibly damaging Het
Por C T 5: 135,732,584 S308L probably benign Het
Prmt8 T A 6: 127,711,874 K178* probably null Het
Rev3l A G 10: 39,817,286 N454S probably damaging Het
Rps6ka2 T C 17: 7,271,610 V309A probably benign Het
Slc15a5 A G 6: 138,018,114 probably benign Het
Snf8 G A 11: 96,039,299 M42I probably benign Het
Stom T C 2: 35,325,359 I65V probably benign Het
Tacr3 C T 3: 134,932,228 T382I probably benign Het
Tenm3 A G 8: 48,228,975 V2540A probably damaging Het
Trabd A G 15: 89,085,613 T314A possibly damaging Het
Tyk2 T C 9: 21,114,190 probably null Het
Ube4a T C 9: 44,944,801 probably benign Het
Unc80 A G 1: 66,549,856 H1060R possibly damaging Het
Virma A T 4: 11,528,626 K1288* probably null Het
Vmn2r100 A C 17: 19,531,320 I542L probably benign Het
Vwde T C 6: 13,187,807 probably benign Het
Zfc3h1 T C 10: 115,409,113 I797T possibly damaging Het
Zfp74 C T 7: 29,954,041 probably benign Het
Zkscan7 T A 9: 122,888,807 L89Q probably damaging Het
Other mutations in Slc30a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Slc30a6 APN 17 74408839 splice site probably benign
IGL01592:Slc30a6 APN 17 74419528 splice site probably benign
IGL02556:Slc30a6 APN 17 74404059 missense probably damaging 1.00
IGL03033:Slc30a6 APN 17 74409378 nonsense probably null
IGL03149:Slc30a6 APN 17 74423023 missense probably damaging 1.00
R0791:Slc30a6 UTSW 17 74415645 missense possibly damaging 0.89
R0792:Slc30a6 UTSW 17 74415645 missense possibly damaging 0.89
R1507:Slc30a6 UTSW 17 74408862 missense probably damaging 1.00
R1517:Slc30a6 UTSW 17 74408847 missense probably benign 0.25
R1585:Slc30a6 UTSW 17 74418615 splice site probably benign
R1944:Slc30a6 UTSW 17 74408863 missense probably damaging 0.99
R2925:Slc30a6 UTSW 17 74402004 splice site probably benign
R3891:Slc30a6 UTSW 17 74419546 missense probably benign 0.19
R4840:Slc30a6 UTSW 17 74405721 missense probably damaging 1.00
R4863:Slc30a6 UTSW 17 74412654 missense possibly damaging 0.84
R5330:Slc30a6 UTSW 17 74423195 missense probably benign 0.24
R5331:Slc30a6 UTSW 17 74423195 missense probably benign 0.24
R5562:Slc30a6 UTSW 17 74412705 missense possibly damaging 0.91
R6458:Slc30a6 UTSW 17 74423113 missense probably damaging 1.00
R6681:Slc30a6 UTSW 17 74404032 missense possibly damaging 0.53
R7419:Slc30a6 UTSW 17 74423429 missense probably benign
R7457:Slc30a6 UTSW 17 74407238 missense probably benign 0.05
R7596:Slc30a6 UTSW 17 74415669 missense probably benign 0.00
R7927:Slc30a6 UTSW 17 74404093 splice site probably null
R8043:Slc30a6 UTSW 17 74423023 missense probably damaging 0.99
T0722:Slc30a6 UTSW 17 74412324 critical splice donor site probably null
X0003:Slc30a6 UTSW 17 74412324 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCGACGAGATGCGAACGAAC -3'
(R):5'- GCAAGAAGTCGCTATTCCCCATCAC -3'

Sequencing Primer
(F):5'- CGAACAAATGGTCCTTGCTC -3'
(R):5'- ACTCCTGGAAATGCGAGTC -3'
Posted On2013-04-24