Incidental Mutation 'R0356:Nr5a2'
ID29808
Institutional Source Beutler Lab
Gene Symbol Nr5a2
Ensembl Gene ENSMUSG00000026398
Gene Namenuclear receptor subfamily 5, group A, member 2
SynonymsD1Ertd308e, Ftf, LRH-1, UF2-H3B
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0356 (G1)
Quality Score193
Status Validated
Chromosome1
Chromosomal Location136842571-136960448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136845692 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 424 (N424S)
Ref Sequence ENSEMBL: ENSMUSP00000141495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027649] [ENSMUST00000168126] [ENSMUST00000192357] [ENSMUST00000192929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027649
AA Change: N485S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027649
Gene: ENSMUSG00000026398
AA Change: N485S

DomainStartEndE-ValueType
ZnF_C4 104 175 2.85e-40 SMART
Blast:HOLI 196 247 1e-5 BLAST
low complexity region 290 302 N/A INTRINSIC
HOLI 366 529 4.13e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168126
AA Change: N424S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129071
Gene: ENSMUSG00000026398
AA Change: N424S

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192357
AA Change: N464S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142219
Gene: ENSMUSG00000026398
AA Change: N464S

DomainStartEndE-ValueType
ZnF_C4 83 154 1.1e-42 SMART
Blast:HOLI 175 226 1e-5 BLAST
low complexity region 269 281 N/A INTRINSIC
HOLI 345 508 1.7e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192929
AA Change: N424S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141495
Gene: ENSMUSG00000026398
AA Change: N424S

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Meta Mutation Damage Score 0.2035 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die around embryonic day 7.5. Heterozygotes are essentially normal but with lower plasma cholesterol, increased bile acids, and shorter intestinal crypt length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Nr5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Nr5a2 APN 1 136890798 missense probably damaging 1.00
IGL01082:Nr5a2 APN 1 136845468 missense probably benign 0.06
IGL02547:Nr5a2 APN 1 136940927 missense probably benign 0.01
IGL02688:Nr5a2 APN 1 136940407 critical splice donor site probably null
IGL02712:Nr5a2 APN 1 136940528 unclassified probably null
aggressivity UTSW 1 136882344 missense possibly damaging 0.78
R0653:Nr5a2 UTSW 1 136948805 missense probably benign 0.04
R1111:Nr5a2 UTSW 1 136882421 splice site probably null
R1728:Nr5a2 UTSW 1 136952125 missense probably benign
R1729:Nr5a2 UTSW 1 136952125 missense probably benign
R1730:Nr5a2 UTSW 1 136952125 missense probably benign
R1739:Nr5a2 UTSW 1 136952125 missense probably benign
R1762:Nr5a2 UTSW 1 136952125 missense probably benign
R1783:Nr5a2 UTSW 1 136952125 missense probably benign
R1784:Nr5a2 UTSW 1 136952125 missense probably benign
R1785:Nr5a2 UTSW 1 136952125 missense probably benign
R1927:Nr5a2 UTSW 1 136944994 missense probably damaging 1.00
R2360:Nr5a2 UTSW 1 136948827 missense probably benign
R3408:Nr5a2 UTSW 1 136940498 missense probably benign
R4662:Nr5a2 UTSW 1 136940429 missense probably benign 0.00
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R5176:Nr5a2 UTSW 1 136948802 start codon destroyed probably null 0.96
R5999:Nr5a2 UTSW 1 136845542 missense probably damaging 1.00
R6191:Nr5a2 UTSW 1 136890798 missense probably damaging 1.00
R6457:Nr5a2 UTSW 1 136960238 missense probably benign 0.00
R6747:Nr5a2 UTSW 1 136882344 missense possibly damaging 0.78
R8170:Nr5a2 UTSW 1 136940647 missense probably benign 0.06
X0012:Nr5a2 UTSW 1 136943292 missense probably damaging 1.00
X0065:Nr5a2 UTSW 1 136940777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATAGGGCACATCCCCGTTCACG -3'
(R):5'- GGACACAGATTTCACCTTGGGTCAG -3'

Sequencing Primer
(F):5'- ACGTGCTTATAGTACAGGTAGTC -3'
(R):5'- TCCCTGGAAGCTTGGTAAAC -3'
Posted On2013-04-24