Incidental Mutation 'R0356:Lcn5'
ID29810
Institutional Source Beutler Lab
Gene Symbol Lcn5
Ensembl Gene ENSMUSG00000026937
Gene Namelipocalin 5
SynonymsmE-RABP, Erabp, MEP10
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25657952-25661977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25660693 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 131 (I131T)
Ref Sequence ENSEMBL: ENSMUSP00000097888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028306] [ENSMUST00000038482] [ENSMUST00000100312] [ENSMUST00000100313]
Predicted Effect probably damaging
Transcript: ENSMUST00000028306
AA Change: I131T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028306
Gene: ENSMUSG00000026937
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Lipocalin 41 180 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038482
SMART Domains Protein: ENSMUSP00000043902
Gene: ENSMUSG00000036449

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lipocalin 33 159 2.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100312
AA Change: I131T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097887
Gene: ENSMUSG00000026937
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Lipocalin 41 180 1.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100313
AA Change: I131T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097888
Gene: ENSMUSG00000026937
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Lipocalin 41 180 2.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143401
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a small secreted protein that is expressed in the epididymis and binds retinoic acid. The precursor protein is processed into both a longer major form and a shorter minor form. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Lcn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Lcn5 APN 2 25660717 missense probably benign 0.00
IGL02093:Lcn5 APN 2 25658450 missense probably damaging 0.96
R0009:Lcn5 UTSW 2 25661405 intron probably benign
R0045:Lcn5 UTSW 2 25660698 missense probably damaging 0.98
R0045:Lcn5 UTSW 2 25660698 missense probably damaging 0.98
R0733:Lcn5 UTSW 2 25661101 missense probably damaging 1.00
R2068:Lcn5 UTSW 2 25658041 missense probably damaging 0.98
R4628:Lcn5 UTSW 2 25658063 missense possibly damaging 0.79
R4963:Lcn5 UTSW 2 25661414 missense probably benign
R5437:Lcn5 UTSW 2 25658011 missense probably benign 0.29
R7624:Lcn5 UTSW 2 25661414 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAAGGTTACCCAGACTCTCAAGG -3'
(R):5'- AGAGCTTCCCCATTGTTGTCCAAG -3'

Sequencing Primer
(F):5'- ACTTCAGGCTGTCCCAGTATG -3'
(R):5'- ATGGGACAGGGCTTCTATATCAC -3'
Posted On2013-04-24