Incidental Mutation 'R0356:9430097D07Rik'
ID29811
Institutional Source Beutler Lab
Gene Symbol 9430097D07Rik
Ensembl Gene ENSMUSG00000075405
Gene NameRIKEN cDNA 9430097D07 gene
Synonyms
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32574184-32575684 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 32574406 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028151] [ENSMUST00000048375] [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000100190] [ENSMUST00000140592]
Predicted Effect probably benign
Transcript: ENSMUST00000028151
SMART Domains Protein: ENSMUSP00000028151
Gene: ENSMUSG00000026810

DomainStartEndE-ValueType
Pfam:DPM2 5 80 4.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048375
SMART Domains Protein: ENSMUSP00000044731
Gene: ENSMUSG00000039157

DomainStartEndE-ValueType
Pfam:NT-C2 6 152 4.8e-32 PFAM
low complexity region 177 194 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000100190
AA Change: H127R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136816
Predicted Effect probably benign
Transcript: ENSMUST00000140592
SMART Domains Protein: ENSMUSP00000124665
Gene: ENSMUSG00000026810

DomainStartEndE-ValueType
Pfam:DPM2 5 68 3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150419
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in 9430097D07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02214:9430097D07Rik APN 2 32574724 unclassified probably benign
R1776:9430097D07Rik UTSW 2 32574755 unclassified probably benign
R4525:9430097D07Rik UTSW 2 32574376 unclassified probably benign
R4886:9430097D07Rik UTSW 2 32574618 unclassified probably benign
R5010:9430097D07Rik UTSW 2 32574428 unclassified probably benign
R5613:9430097D07Rik UTSW 2 32575334 unclassified probably benign
R7059:9430097D07Rik UTSW 2 32574497 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGCATCCACACAGCCTGAAAG -3'
(R):5'- ATGATAGTCCCTAGCACGCAGAGC -3'

Sequencing Primer
(F):5'- caggatttggaggcaggg -3'
(R):5'- TAGCACGCAGAGCCTTGG -3'
Posted On2013-04-24