Incidental Mutation 'R0356:Sirpb1c'
ID29816
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Namesignal-regulatory protein beta 1C
Synonyms
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0356 (G1)
Quality Score224
Status Validated
Chromosome3
Chromosomal Location15795145-15848528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15833145 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 175 (N175D)
Ref Sequence ENSEMBL: ENSMUSP00000103986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354]
Predicted Effect probably benign
Transcript: ENSMUST00000050623
AA Change: N177D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677
AA Change: N177D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108349
AA Change: N175D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677
AA Change: N175D

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108350
AA Change: N177D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677
AA Change: N177D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108352
AA Change: N177D

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677
AA Change: N177D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108354
AA Change: N177D

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677
AA Change: N177D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124067
Predicted Effect unknown
Transcript: ENSMUST00000148194
AA Change: N45D
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677
AA Change: N45D

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191802
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15838773 missense probably benign 0.06
R0094:Sirpb1c UTSW 3 15838758 missense possibly damaging 0.73
R0442:Sirpb1c UTSW 3 15802546 missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15833123 missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15833222 missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15832076 missense probably benign 0.00
R6315:Sirpb1c UTSW 3 15832306 missense possibly damaging 0.71
R7107:Sirpb1c UTSW 3 15838777 missense possibly damaging 0.91
R7148:Sirpb1c UTSW 3 15833059 nonsense probably null
R7349:Sirpb1c UTSW 3 15832146 critical splice donor site probably null
R7356:Sirpb1c UTSW 3 15832133 missense probably benign
R7359:Sirpb1c UTSW 3 15833225 missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15832266 missense probably damaging 1.00
R7629:Sirpb1c UTSW 3 15848395 missense possibly damaging 0.86
R7720:Sirpb1c UTSW 3 15832072 missense probably benign 0.00
R7726:Sirpb1c UTSW 3 15848386 missense possibly damaging 0.92
R7853:Sirpb1c UTSW 3 15832992 missense probably damaging 1.00
R7886:Sirpb1c UTSW 3 15832202 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGAGAGGGGCTCGATCTAAAGTGAC -3'
(R):5'- TGCCTGGTAACAACAATCCTGACAG -3'

Sequencing Primer
(F):5'- GCTCGATCTAAAGTGACATGATCC -3'
(R):5'- TGGTAACAACAATCCTGACAGTAAAC -3'
Posted On2013-04-24