Incidental Mutation 'R0356:Ccdc62'
ID29820
Institutional Source Beutler Lab
Gene Symbol Ccdc62
Ensembl Gene ENSMUSG00000061882
Gene Namecoiled-coil domain containing 62
SynonymsLOC208908
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123930679-123969895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123954748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 599 (V599I)
Ref Sequence ENSEMBL: ENSMUSP00000127483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094320] [ENSMUST00000165148]
Predicted Effect probably benign
Transcript: ENSMUST00000094320
AA Change: V599I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091878
Gene: ENSMUSG00000061882
AA Change: V599I

DomainStartEndE-ValueType
coiled coil region 61 197 N/A INTRINSIC
coiled coil region 241 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165148
AA Change: V599I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127483
Gene: ENSMUSG00000061882
AA Change: V599I

DomainStartEndE-ValueType
coiled coil region 61 197 N/A INTRINSIC
coiled coil region 241 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169898
SMART Domains Protein: ENSMUSP00000132294
Gene: ENSMUSG00000061882

DomainStartEndE-ValueType
coiled coil region 31 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171881
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced mutation or a deletion knockout exhibit male reproductive abnormalities including infertility, low sperm count, abnormal sperm head and tail morphology, very low sperm motility, and low seminal vesicle weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Ccdc62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Ccdc62 APN 5 123954576 missense possibly damaging 0.83
IGL02491:Ccdc62 APN 5 123961315 missense probably damaging 1.00
IGL02634:Ccdc62 APN 5 123954257 missense probably benign 0.03
IGL02938:Ccdc62 APN 5 123934184 missense probably benign 0.30
IGL03274:Ccdc62 APN 5 123954680 missense probably benign 0.00
IGL03293:Ccdc62 APN 5 123951225 missense possibly damaging 0.95
Condensed UTSW 5 123934093 missense probably benign 0.00
R3915:Ccdc62 UTSW 5 123954715 missense probably damaging 1.00
R4708:Ccdc62 UTSW 5 123930862 critical splice donor site probably null
R5731:Ccdc62 UTSW 5 123951289 critical splice donor site probably null
R6354:Ccdc62 UTSW 5 123944204 missense probably damaging 0.96
R6681:Ccdc62 UTSW 5 123934093 missense probably benign 0.00
R7340:Ccdc62 UTSW 5 123951220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGACCTGTCCGAGTCCAAGTG -3'
(R):5'- AAACCTCTGCCTTAGAAGCTGCC -3'

Sequencing Primer
(F):5'- AGTCCAAGTGCTGCCAC -3'
(R):5'- AAAGACCCCTGTGTCTATGCG -3'
Posted On2013-04-24