Incidental Mutation 'R0356:Tigar'
ID29822
Institutional Source Beutler Lab
Gene Symbol Tigar
Ensembl Gene ENSMUSG00000038028
Gene NameTrp53 induced glycolysis repulatory phosphatase
Synonyms9630033F20Rik, Tigar
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location127085116-127109557 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127091182 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039913] [ENSMUST00000200988]
Predicted Effect probably null
Transcript: ENSMUST00000039913
SMART Domains Protein: ENSMUSP00000048643
Gene: ENSMUSG00000038028

DomainStartEndE-ValueType
PGAM 5 205 8.71e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200988
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is regulated as part of the p53 tumor suppressor pathway and encodes a protein with sequence similarity to the bisphosphate domain of the glycolytic enzyme that degrades fructose-2,6-bisphosphate. The protein functions by blocking glycolysis and directing the pathway into the pentose phosphate shunt. Expression of this protein also protects cells from DNA damaging reactive oxygen species and provides some protection from DNA damage-induced apoptosis. The 12p13.32 region that includes this gene is paralogous to the 11q13.3 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit improved response to myocardial infarction associated with increased autophagy, mitophagy, levels of reactive oxygen species production and decreased mitochondria DNA damage. Mice homozygous for a different allele exhibit impaired crypt regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Tigar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Tigar APN 6 127088079 missense probably damaging 0.98
IGL01099:Tigar APN 6 127088145 missense probably benign
IGL02021:Tigar APN 6 127089290 missense probably damaging 0.97
R1972:Tigar UTSW 6 127087926 missense possibly damaging 0.62
R5492:Tigar UTSW 6 127089204 missense possibly damaging 0.80
R6063:Tigar UTSW 6 127091201 missense probably benign 0.00
R7447:Tigar UTSW 6 127088166 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AATCCCCAAGAAAgggctggaga -3'
(R):5'- TGAAGAGAAGCCAcaaaccccg -3'

Sequencing Primer
(F):5'- gcacacctttaatcccagcac -3'
(R):5'- gctctgccactgagctg -3'
Posted On2013-04-24