Incidental Mutation 'R0356:Hhip'
ID29826
Institutional Source Beutler Lab
Gene Symbol Hhip
Ensembl Gene ENSMUSG00000064325
Gene NameHedgehog-interacting protein
SynonymsHip, Hhip1, Hip1
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location79965851-80058006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79997492 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 374 (I374V)
Ref Sequence ENSEMBL: ENSMUSP00000078047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079038]
Predicted Effect probably benign
Transcript: ENSMUST00000079038
AA Change: I374V

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078047
Gene: ENSMUSG00000064325
AA Change: I374V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Folate_rec 38 220 4.9e-26 PFAM
Pfam:GSDH 226 444 3e-22 PFAM
EGF 593 635 9.63e0 SMART
EGF 638 667 2.35e-2 SMART
Meta Mutation Damage Score 0.0734 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hedgehog-interacting protein (HHIP) family. The hedgehog (HH) proteins are evolutionarily conserved protein, which are important morphogens for a wide range of developmental processes, including anteroposterior patterns of limbs and regulation of left-right asymmetry in embryonic development. Multiple cell-surface receptors are responsible for transducing and/or regulating HH signals. The HHIP encoded by this gene is a highly conserved, vertebrate-specific inhibitor of HH signaling. It interacts with all three HH family members, SHH, IHH and DHH. Two single nucleotide polymorphisms (SNPs) near this gene are significantly associated with risk of chronic obstructive pulmonary disease (COPD). A single nucleotide polymorphism in this gene is also strongly associated with human height.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a reporter allele die shortly after birth due to respiratory failure, show defects in lung, spleen and pancreas morphogenesis, and exhibit small and disorganized pancreatic islets and reduced beta-cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Hhip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Hhip APN 8 79996783 missense probably damaging 0.96
IGL02560:Hhip APN 8 79987009 missense probably damaging 0.98
IGL03046:Hhip UTSW 8 79972338 missense probably damaging 0.99
R0068:Hhip UTSW 8 79989256 missense probably damaging 1.00
R0707:Hhip UTSW 8 79998255 missense probably damaging 1.00
R1163:Hhip UTSW 8 79992476 missense probably damaging 1.00
R1583:Hhip UTSW 8 79990276 missense probably damaging 1.00
R1900:Hhip UTSW 8 79975046 missense probably benign 0.15
R2071:Hhip UTSW 8 80057302 missense probably benign 0.00
R2255:Hhip UTSW 8 80045181 missense probably damaging 0.98
R3847:Hhip UTSW 8 79997495 missense probably benign 0.00
R4012:Hhip UTSW 8 79992594 missense probably damaging 1.00
R4448:Hhip UTSW 8 80043945 critical splice donor site probably null
R4607:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4608:Hhip UTSW 8 79997563 missense probably damaging 0.99
R4677:Hhip UTSW 8 80045097 missense probably damaging 0.96
R4738:Hhip UTSW 8 79992570 missense probably damaging 0.98
R5040:Hhip UTSW 8 79997606 missense probably benign 0.00
R5371:Hhip UTSW 8 79997591 missense probably damaging 0.98
R5594:Hhip UTSW 8 79996863 missense probably damaging 1.00
R5785:Hhip UTSW 8 79998192 missense possibly damaging 0.84
R6026:Hhip UTSW 8 79972440 missense probably damaging 1.00
R6259:Hhip UTSW 8 79972404 missense probably damaging 1.00
R6782:Hhip UTSW 8 80051604 missense probably damaging 1.00
R7105:Hhip UTSW 8 79975009 missense probably benign 0.04
R7134:Hhip UTSW 8 79992513 missense probably benign
R7238:Hhip UTSW 8 79987012 missense probably benign
R7828:Hhip UTSW 8 79998208 missense probably benign 0.00
X0026:Hhip UTSW 8 79992560 missense possibly damaging 0.93
Z1177:Hhip UTSW 8 80057251 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGAACACATGGCAAGGTTGCTC -3'
(R):5'- ACCTGCAAAGTCATGGTGCTCTC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- GTCATGGTGCTCTCCCCTC -3'
Posted On2013-04-24