Incidental Mutation 'R0356:Olfr857'
ID29828
Institutional Source Beutler Lab
Gene Symbol Olfr857
Ensembl Gene ENSMUSG00000094678
Gene Nameolfactory receptor 857
SynonymsMOR146-8P, GA_x6K02T2PVTD-13452606-13453535
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19709433-19714930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19713447 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 207 (G207C)
Ref Sequence ENSEMBL: ENSMUSP00000148617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]
Predicted Effect probably damaging
Transcript: ENSMUST00000077023
AA Change: G207C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: G207C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.5e-5 PFAM
Pfam:7tm_1 41 290 9.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212013
AA Change: G207C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212753
AA Change: G172C
Predicted Effect probably benign
Transcript: ENSMUST00000217450
AA Change: G207C

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.4370 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Olfr857
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr857 APN 9 19713279 missense probably benign 0.00
IGL01919:Olfr857 APN 9 19713342 missense probably benign 0.00
IGL02157:Olfr857 APN 9 19713289 missense probably benign 0.07
IGL02550:Olfr857 APN 9 19713047 missense possibly damaging 0.92
IGL03329:Olfr857 APN 9 19713301 missense probably benign 0.16
IGL02799:Olfr857 UTSW 9 19713018 missense probably damaging 0.99
R0927:Olfr857 UTSW 9 19713649 missense probably benign 0.39
R1161:Olfr857 UTSW 9 19713180 missense probably damaging 1.00
R1848:Olfr857 UTSW 9 19713090 missense probably benign 0.01
R5191:Olfr857 UTSW 9 19713334 missense probably damaging 0.98
R5216:Olfr857 UTSW 9 19713289 missense probably benign 0.07
R5259:Olfr857 UTSW 9 19712813 intron probably null
R5342:Olfr857 UTSW 9 19713037 missense probably damaging 1.00
R5506:Olfr857 UTSW 9 19713274 missense possibly damaging 0.61
R5526:Olfr857 UTSW 9 19713698 nonsense probably null
R5594:Olfr857 UTSW 9 19713006 missense probably damaging 0.99
R5928:Olfr857 UTSW 9 19713753 missense probably benign 0.02
R6569:Olfr857 UTSW 9 19713342 missense probably benign 0.00
R6858:Olfr857 UTSW 9 19713469 missense probably damaging 0.98
R7077:Olfr857 UTSW 9 19713132 missense probably benign
R7378:Olfr857 UTSW 9 19712887 missense probably damaging 1.00
R7771:Olfr857 UTSW 9 19713471 missense probably benign
R8038:Olfr857 UTSW 9 19713680 missense possibly damaging 0.52
R8223:Olfr857 UTSW 9 19713409 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAAGTCATTCTAAGCCCTTGCC -3'
(R):5'- GCGACCATACTTTCCCTGGAAGAAC -3'

Sequencing Primer
(F):5'- CTGTAGATGTTTGGTCATAGTTTCCC -3'
(R):5'- TTCCCTGGAAGAACTAGAAACTGTG -3'
Posted On2013-04-24