Incidental Mutation 'R0356:Zfp426'
ID29829
Institutional Source Beutler Lab
Gene Symbol Zfp426
Ensembl Gene ENSMUSG00000059475
Gene Namezinc finger protein 426
SynonymsZfo61, Zfp68-rs1, 2900057C04Rik, KRAB1
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0356 (G1)
Quality Score209
Status Validated
Chromosome9
Chromosomal Location20468549-20492746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20471245 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 135 (T135A)
Ref Sequence ENSEMBL: ENSMUSP00000127914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080386] [ENSMUST00000115562] [ENSMUST00000163348] [ENSMUST00000163427] [ENSMUST00000164799] [ENSMUST00000164825] [ENSMUST00000166005] [ENSMUST00000167457] [ENSMUST00000168095] [ENSMUST00000169269] [ENSMUST00000169558]
Predicted Effect probably benign
Transcript: ENSMUST00000080386
AA Change: T135A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000079250
Gene: ENSMUSG00000059475
AA Change: T135A

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115562
AA Change: T135A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111224
Gene: ENSMUSG00000059475
AA Change: T135A

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163348
AA Change: T134A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126446
Gene: ENSMUSG00000059475
AA Change: T134A

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 218 240 2.12e-4 SMART
ZnF_C2H2 273 295 1.69e-3 SMART
ZnF_C2H2 301 323 8.81e-2 SMART
ZnF_C2H2 329 351 5.59e-4 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 1.43e-1 SMART
ZnF_C2H2 413 435 1.79e-2 SMART
ZnF_C2H2 441 463 1.22e-4 SMART
ZnF_C2H2 469 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.58e-2 SMART
ZnF_C2H2 527 549 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163427
Predicted Effect probably benign
Transcript: ENSMUST00000164799
SMART Domains Protein: ENSMUSP00000130120
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 53 93 1.2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164825
AA Change: T135A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127914
Gene: ENSMUSG00000059475
AA Change: T135A

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166005
AA Change: T135A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000129727
Gene: ENSMUSG00000059475
AA Change: T135A

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166465
Predicted Effect probably benign
Transcript: ENSMUST00000167457
AA Change: T68A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130945
Gene: ENSMUSG00000059475
AA Change: T68A

DomainStartEndE-ValueType
KRAB 1 32 1.46e0 SMART
ZnF_C2H2 152 174 2.12e-4 SMART
ZnF_C2H2 207 229 1.69e-3 SMART
ZnF_C2H2 235 257 8.81e-2 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 3.16e-3 SMART
ZnF_C2H2 319 341 1.43e-1 SMART
ZnF_C2H2 347 369 1.79e-2 SMART
ZnF_C2H2 375 397 1.22e-4 SMART
ZnF_C2H2 403 425 1.38e-3 SMART
ZnF_C2H2 431 453 3.58e-2 SMART
ZnF_C2H2 461 483 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168095
SMART Domains Protein: ENSMUSP00000130309
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 83 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169269
SMART Domains Protein: ENSMUSP00000128843
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 69 7.16e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169558
AA Change: T149A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127045
Gene: ENSMUSG00000059475
AA Change: T149A

DomainStartEndE-ValueType
KRAB 53 113 5.56e-31 SMART
ZnF_C2H2 233 255 2.12e-4 SMART
ZnF_C2H2 288 310 1.69e-3 SMART
ZnF_C2H2 316 338 8.81e-2 SMART
ZnF_C2H2 344 366 5.59e-4 SMART
ZnF_C2H2 372 394 3.16e-3 SMART
ZnF_C2H2 400 422 1.43e-1 SMART
ZnF_C2H2 428 450 1.79e-2 SMART
ZnF_C2H2 456 478 1.22e-4 SMART
ZnF_C2H2 484 506 1.38e-3 SMART
ZnF_C2H2 512 534 3.58e-2 SMART
ZnF_C2H2 542 564 3.44e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kaposi's sarcoma-associated herpesvirus (KSHV) can be reactivated from latency by the viral protein RTA. The protein encoded by this gene is a zinc finger transcriptional repressor that interacts with RTA to modulate RTA-mediated reactivation of KSHV. While the encoded protein can repress KSHV reactivation, RTA can induce degradation of this protein through the ubiquitin-proteasome pathway to overcome the repression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Other mutations in Zfp426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Zfp426 APN 9 20478157 start codon destroyed possibly damaging 0.93
IGL02499:Zfp426 APN 9 20473118 splice site probably benign
R0157:Zfp426 UTSW 9 20471136 missense probably benign 0.00
R0456:Zfp426 UTSW 9 20470297 missense probably damaging 1.00
R0504:Zfp426 UTSW 9 20470031 missense probably damaging 0.96
R2352:Zfp426 UTSW 9 20470105 missense probably benign 0.08
R2507:Zfp426 UTSW 9 20470431 missense probably benign 0.00
R2509:Zfp426 UTSW 9 20470681 missense possibly damaging 0.68
R3771:Zfp426 UTSW 9 20473117 splice site probably null
R3772:Zfp426 UTSW 9 20473117 splice site probably null
R3773:Zfp426 UTSW 9 20473117 splice site probably null
R3864:Zfp426 UTSW 9 20470086 missense possibly damaging 0.88
R4649:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R4798:Zfp426 UTSW 9 20471014 missense probably benign 0.17
R4863:Zfp426 UTSW 9 20470038 missense probably damaging 1.00
R4894:Zfp426 UTSW 9 20475073 intron probably benign
R5421:Zfp426 UTSW 9 20470719 missense probably damaging 0.99
R6084:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R6610:Zfp426 UTSW 9 20473093 missense probably damaging 1.00
R7239:Zfp426 UTSW 9 20470591 missense probably benign 0.00
R7441:Zfp426 UTSW 9 20470851 missense possibly damaging 0.95
R7646:Zfp426 UTSW 9 20470024 missense probably damaging 0.98
R7827:Zfp426 UTSW 9 20470150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGGTTTCTTCACTCTGACTGAAC -3'
(R):5'- TGTGCAATGAACCTCACTGCTCC -3'

Sequencing Primer
(F):5'- CTGACTGAACTCAGAAAGTTTCTCAC -3'
(R):5'- AAAGCACATCTTTTTCTTGGAGTGG -3'
Posted On2013-04-24