Incidental Mutation 'R0356:Ap3d1'
ID29832
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80727978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 122 (S122R)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably damaging
Transcript: ENSMUST00000020420
AA Change: S122R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: S122R

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 intron probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTAGACCACCAGGCAGTATCCAGAG -3'
(R):5'- CCAGGAAGTTGTCCAGGAGTTGTG -3'

Sequencing Primer
(F):5'- AAGCAAGGCTGACTTTTGCTC -3'
(R):5'- GACTTGCAAAGGAATCTCTGTCC -3'
Posted On2013-04-24