Incidental Mutation 'R0356:Ap3d1'
ID 29832
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Name adaptor-related protein complex 3, delta 1 subunit
Synonyms mBLVR1, Bolvr
MMRRC Submission 038562-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R0356 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80542790-80578098 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 80563812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 122 (S122R)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
AlphaFold O54774
Predicted Effect probably damaging
Transcript: ENSMUST00000020420
AA Change: S122R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: S122R

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219356
Meta Mutation Damage Score 0.4800 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,464,418 (GRCm39) probably benign Het
Adgrg6 C T 10: 14,302,642 (GRCm39) V924M possibly damaging Het
Anxa9 A G 3: 95,215,387 (GRCm39) probably benign Het
Arhgap5 T C 12: 52,563,091 (GRCm39) S21P probably damaging Het
Atp13a5 A G 16: 29,167,573 (GRCm39) probably benign Het
AU040320 A T 4: 126,731,155 (GRCm39) D618V probably damaging Het
Cbfa2t2 T A 2: 154,373,269 (GRCm39) D475E probably benign Het
Ccdc202 T A 14: 96,119,801 (GRCm39) V186E possibly damaging Het
Ccdc62 G A 5: 124,092,811 (GRCm39) V599I probably benign Het
Cenpj T C 14: 56,786,953 (GRCm39) E917G probably damaging Het
Cog5 T C 12: 31,887,180 (GRCm39) probably benign Het
Col9a1 T A 1: 24,224,328 (GRCm39) L170* probably null Het
Daxx T A 17: 34,132,867 (GRCm39) V627D probably benign Het
Dnah9 A G 11: 66,021,388 (GRCm39) probably null Het
Drg2 T A 11: 60,352,407 (GRCm39) V203E probably damaging Het
Fbxl17 G A 17: 63,663,846 (GRCm39) R67C probably damaging Het
Fer1l4 T C 2: 155,865,930 (GRCm39) Y1586C probably damaging Het
Gp6 A T 7: 4,373,141 (GRCm39) probably benign Het
Hhip T C 8: 80,724,121 (GRCm39) I374V probably benign Het
Hspa12b G T 2: 130,986,719 (GRCm39) V547L possibly damaging Het
Iars1 G A 13: 49,856,709 (GRCm39) V321I probably benign Het
Itga8 T C 2: 12,187,532 (GRCm39) M716V possibly damaging Het
Lcn5 T C 2: 25,550,705 (GRCm39) I131T probably damaging Het
Mki67 G A 7: 135,306,135 (GRCm39) T614M probably benign Het
Mmp3 G A 9: 7,451,768 (GRCm39) E369K probably benign Het
Myt1l A G 12: 29,861,500 (GRCm39) D94G unknown Het
Neil1 T C 9: 57,054,180 (GRCm39) I47V possibly damaging Het
Nr5a2 T C 1: 136,773,430 (GRCm39) N424S possibly damaging Het
Or1e21 A T 11: 73,344,906 (GRCm39) I44N possibly damaging Het
Or51f5 A T 7: 102,424,286 (GRCm39) D185V probably damaging Het
Or5b120 A G 19: 13,480,441 (GRCm39) T245A possibly damaging Het
Or7e166 G T 9: 19,624,743 (GRCm39) G207C probably damaging Het
Pakap C A 4: 57,855,628 (GRCm39) T360K possibly damaging Het
Pde8b G T 13: 95,182,962 (GRCm39) N265K probably damaging Het
Prpf40b T C 15: 99,203,080 (GRCm39) probably null Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Sirpb1c T C 3: 15,887,309 (GRCm39) N175D possibly damaging Het
Srgap1 A T 10: 121,691,441 (GRCm39) probably null Het
Tgm5 T A 2: 120,884,055 (GRCm39) T313S probably damaging Het
Tigar A G 6: 127,068,145 (GRCm39) probably null Het
Tmprss11b A G 5: 86,808,326 (GRCm39) *417Q probably null Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Ttll11 T C 2: 35,792,688 (GRCm39) D385G possibly damaging Het
Zfp426 T C 9: 20,382,541 (GRCm39) T135A probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80,577,813 (GRCm39) missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80,549,393 (GRCm39) missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80,554,993 (GRCm39) missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80,545,092 (GRCm39) nonsense probably null
IGL03404:Ap3d1 APN 10 80,565,871 (GRCm39) missense probably damaging 1.00
christian UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
Particle UTSW 10 80,546,328 (GRCm39) splice site probably null
vesicle UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80,559,449 (GRCm39) splice site probably benign
R0197:Ap3d1 UTSW 10 80,565,876 (GRCm39) missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80,559,401 (GRCm39) missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80,555,075 (GRCm39) missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80,555,216 (GRCm39) nonsense probably null
R0792:Ap3d1 UTSW 10 80,544,313 (GRCm39) missense probably benign
R0942:Ap3d1 UTSW 10 80,568,789 (GRCm39) splice site probably benign
R1015:Ap3d1 UTSW 10 80,552,323 (GRCm39) missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80,550,092 (GRCm39) missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80,568,674 (GRCm39) splice site probably benign
R1540:Ap3d1 UTSW 10 80,551,775 (GRCm39) missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80,565,844 (GRCm39) missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80,553,571 (GRCm39) nonsense probably null
R1669:Ap3d1 UTSW 10 80,546,670 (GRCm39) unclassified probably benign
R1839:Ap3d1 UTSW 10 80,562,942 (GRCm39) missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80,545,607 (GRCm39) missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80,568,770 (GRCm39) missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80,556,966 (GRCm39) missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80,549,832 (GRCm39) missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80,555,006 (GRCm39) nonsense probably null
R2849:Ap3d1 UTSW 10 80,577,742 (GRCm39) missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80,548,019 (GRCm39) missense probably benign
R4350:Ap3d1 UTSW 10 80,555,119 (GRCm39) missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80,555,646 (GRCm39) nonsense probably null
R4782:Ap3d1 UTSW 10 80,557,420 (GRCm39) splice site probably null
R4785:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R4834:Ap3d1 UTSW 10 80,555,560 (GRCm39) missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80,548,612 (GRCm39) frame shift probably null
R5051:Ap3d1 UTSW 10 80,555,033 (GRCm39) missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80,545,284 (GRCm39) missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80,545,651 (GRCm39) missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80,563,001 (GRCm39) missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80,559,383 (GRCm39) missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80,554,964 (GRCm39) missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80,549,871 (GRCm39) missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80,546,298 (GRCm39) missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80,558,761 (GRCm39) missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80,546,328 (GRCm39) splice site probably null
R6469:Ap3d1 UTSW 10 80,547,992 (GRCm39) missense probably benign
R6603:Ap3d1 UTSW 10 80,549,881 (GRCm39) missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80,550,156 (GRCm39) nonsense probably null
R6887:Ap3d1 UTSW 10 80,559,532 (GRCm39) missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80,577,767 (GRCm39) missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80,553,693 (GRCm39) missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80,559,637 (GRCm39) missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80,566,716 (GRCm39) missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80,577,734 (GRCm39) missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80,557,426 (GRCm39) missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80,558,755 (GRCm39) missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80,545,292 (GRCm39) missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80,553,678 (GRCm39) missense probably damaging 1.00
R7964:Ap3d1 UTSW 10 80,565,891 (GRCm39) missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80,550,135 (GRCm39) missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80,558,766 (GRCm39) nonsense probably null
R8314:Ap3d1 UTSW 10 80,559,373 (GRCm39) missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80,568,737 (GRCm39) missense probably damaging 1.00
R8896:Ap3d1 UTSW 10 80,552,425 (GRCm39) missense probably benign 0.01
R8936:Ap3d1 UTSW 10 80,547,952 (GRCm39) missense probably benign 0.02
R9183:Ap3d1 UTSW 10 80,545,627 (GRCm39) missense probably null 0.06
R9209:Ap3d1 UTSW 10 80,554,918 (GRCm39) missense probably benign 0.04
R9259:Ap3d1 UTSW 10 80,559,661 (GRCm39) missense probably damaging 1.00
R9476:Ap3d1 UTSW 10 80,545,655 (GRCm39) missense probably benign 0.00
R9645:Ap3d1 UTSW 10 80,545,062 (GRCm39) missense probably benign
R9664:Ap3d1 UTSW 10 80,548,639 (GRCm39) missense possibly damaging 0.71
R9781:Ap3d1 UTSW 10 80,545,609 (GRCm39) missense possibly damaging 0.51
X0019:Ap3d1 UTSW 10 80,554,936 (GRCm39) missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80,556,981 (GRCm39) missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80,555,071 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTAGACCACCAGGCAGTATCCAGAG -3'
(R):5'- CCAGGAAGTTGTCCAGGAGTTGTG -3'

Sequencing Primer
(F):5'- AAGCAAGGCTGACTTTTGCTC -3'
(R):5'- GACTTGCAAAGGAATCTCTGTCC -3'
Posted On 2013-04-24