Incidental Mutation 'R0356:Cog5'
ID29838
Institutional Source Beutler Lab
Gene Symbol Cog5
Ensembl Gene ENSMUSG00000035933
Gene Namecomponent of oligomeric golgi complex 5
Synonyms5430405C01Rik, GOLTC1, GTC90
MMRRC Submission 038562-MU
Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0356 (G1)
Quality Score166
Status Validated
Chromosome12
Chromosomal Location31654869-31937630 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 31837181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]
Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Cog5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cog5 APN 12 31685704 missense probably damaging 1.00
IGL00495:Cog5 APN 12 31837309 missense probably benign 0.06
IGL00763:Cog5 APN 12 31665532 splice site probably benign
IGL00789:Cog5 APN 12 31760952 missense possibly damaging 0.95
IGL01288:Cog5 APN 12 31886206 missense probably benign 0.13
IGL01315:Cog5 APN 12 31760986 splice site probably benign
IGL01396:Cog5 APN 12 31894096 missense probably benign 0.01
IGL02468:Cog5 APN 12 31837358 critical splice donor site probably null
IGL03030:Cog5 APN 12 31790922 missense probably damaging 0.99
IGL03346:Cog5 APN 12 31894038 missense possibly damaging 0.88
R0201:Cog5 UTSW 12 31839841 missense probably damaging 0.99
R0492:Cog5 UTSW 12 31869461 missense probably damaging 1.00
R0646:Cog5 UTSW 12 31837359 splice site probably benign
R0971:Cog5 UTSW 12 31919678 missense probably benign 0.11
R1158:Cog5 UTSW 12 31870057 splice site probably benign
R1997:Cog5 UTSW 12 31660849 missense possibly damaging 0.66
R2167:Cog5 UTSW 12 31837289 missense probably damaging 0.99
R4414:Cog5 UTSW 12 31660854 nonsense probably null
R4755:Cog5 UTSW 12 31869406 splice site probably null
R4836:Cog5 UTSW 12 31919733 missense probably benign 0.07
R5017:Cog5 UTSW 12 31920605 missense probably benign 0.29
R5256:Cog5 UTSW 12 31886205 missense probably benign
R5986:Cog5 UTSW 12 31660717 missense probably benign 0.03
R6131:Cog5 UTSW 12 31886221 missense possibly damaging 0.47
R6885:Cog5 UTSW 12 31894199 missense probably damaging 1.00
R7056:Cog5 UTSW 12 31665469 missense possibly damaging 0.65
R7177:Cog5 UTSW 12 31760889 missense probably damaging 1.00
R7182:Cog5 UTSW 12 31685708 missense probably damaging 1.00
R7418:Cog5 UTSW 12 31833241 missense probably damaging 1.00
R7445:Cog5 UTSW 12 31919672 missense possibly damaging 0.64
R7585:Cog5 UTSW 12 31760889 missense probably damaging 1.00
X0062:Cog5 UTSW 12 31685692 missense probably benign 0.01
Z1177:Cog5 UTSW 12 31801985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGATGGTTAGCATCAGCG -3'
(R):5'- CTAGGAGGCCATTCCATCAGCAAG -3'

Sequencing Primer
(F):5'- TTTCAGGGGACTGCCAATAC -3'
(R):5'- GCAAGGCGTACCTTGTTATAGTC -3'
Posted On2013-04-24