Incidental Mutation 'R0356:Arhgap5'
ID 29839
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene Name Rho GTPase activating protein 5
Synonyms p190B, p190-B
MMRRC Submission 038562-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0356 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 52550755-52618758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52563091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 21 (S21P)
Ref Sequence ENSEMBL: ENSMUSP00000151809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110725
AA Change: S21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: S21P

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218869
Predicted Effect probably damaging
Transcript: ENSMUST00000219443
AA Change: S21P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6622 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,464,418 (GRCm39) probably benign Het
Adgrg6 C T 10: 14,302,642 (GRCm39) V924M possibly damaging Het
Anxa9 A G 3: 95,215,387 (GRCm39) probably benign Het
Ap3d1 G T 10: 80,563,812 (GRCm39) S122R probably damaging Het
Atp13a5 A G 16: 29,167,573 (GRCm39) probably benign Het
AU040320 A T 4: 126,731,155 (GRCm39) D618V probably damaging Het
Cbfa2t2 T A 2: 154,373,269 (GRCm39) D475E probably benign Het
Ccdc202 T A 14: 96,119,801 (GRCm39) V186E possibly damaging Het
Ccdc62 G A 5: 124,092,811 (GRCm39) V599I probably benign Het
Cenpj T C 14: 56,786,953 (GRCm39) E917G probably damaging Het
Cog5 T C 12: 31,887,180 (GRCm39) probably benign Het
Col9a1 T A 1: 24,224,328 (GRCm39) L170* probably null Het
Daxx T A 17: 34,132,867 (GRCm39) V627D probably benign Het
Dnah9 A G 11: 66,021,388 (GRCm39) probably null Het
Drg2 T A 11: 60,352,407 (GRCm39) V203E probably damaging Het
Fbxl17 G A 17: 63,663,846 (GRCm39) R67C probably damaging Het
Fer1l4 T C 2: 155,865,930 (GRCm39) Y1586C probably damaging Het
Gp6 A T 7: 4,373,141 (GRCm39) probably benign Het
Hhip T C 8: 80,724,121 (GRCm39) I374V probably benign Het
Hspa12b G T 2: 130,986,719 (GRCm39) V547L possibly damaging Het
Iars1 G A 13: 49,856,709 (GRCm39) V321I probably benign Het
Itga8 T C 2: 12,187,532 (GRCm39) M716V possibly damaging Het
Lcn5 T C 2: 25,550,705 (GRCm39) I131T probably damaging Het
Mki67 G A 7: 135,306,135 (GRCm39) T614M probably benign Het
Mmp3 G A 9: 7,451,768 (GRCm39) E369K probably benign Het
Myt1l A G 12: 29,861,500 (GRCm39) D94G unknown Het
Neil1 T C 9: 57,054,180 (GRCm39) I47V possibly damaging Het
Nr5a2 T C 1: 136,773,430 (GRCm39) N424S possibly damaging Het
Or1e21 A T 11: 73,344,906 (GRCm39) I44N possibly damaging Het
Or51f5 A T 7: 102,424,286 (GRCm39) D185V probably damaging Het
Or5b120 A G 19: 13,480,441 (GRCm39) T245A possibly damaging Het
Or7e166 G T 9: 19,624,743 (GRCm39) G207C probably damaging Het
Pakap C A 4: 57,855,628 (GRCm39) T360K possibly damaging Het
Pde8b G T 13: 95,182,962 (GRCm39) N265K probably damaging Het
Prpf40b T C 15: 99,203,080 (GRCm39) probably null Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Sirpb1c T C 3: 15,887,309 (GRCm39) N175D possibly damaging Het
Srgap1 A T 10: 121,691,441 (GRCm39) probably null Het
Tgm5 T A 2: 120,884,055 (GRCm39) T313S probably damaging Het
Tigar A G 6: 127,068,145 (GRCm39) probably null Het
Tmprss11b A G 5: 86,808,326 (GRCm39) *417Q probably null Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Ttll11 T C 2: 35,792,688 (GRCm39) D385G possibly damaging Het
Zfp426 T C 9: 20,382,541 (GRCm39) T135A probably benign Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52,564,064 (GRCm39) missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52,565,525 (GRCm39) missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52,563,643 (GRCm39) missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52,565,023 (GRCm39) missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52,563,644 (GRCm39) missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52,565,136 (GRCm39) missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52,609,123 (GRCm39) missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52,563,748 (GRCm39) missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52,564,094 (GRCm39) missense probably damaging 0.99
Decline UTSW 12 52,563,365 (GRCm39) nonsense probably null
Pass UTSW 12 52,563,290 (GRCm39) missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52,565,665 (GRCm39) missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52,565,518 (GRCm39) nonsense probably null
R0088:Arhgap5 UTSW 12 52,563,331 (GRCm39) missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52,563,500 (GRCm39) missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52,606,743 (GRCm39) splice site probably benign
R0616:Arhgap5 UTSW 12 52,563,848 (GRCm39) missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52,564,951 (GRCm39) missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52,563,290 (GRCm39) missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52,566,406 (GRCm39) missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52,563,927 (GRCm39) missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52,565,153 (GRCm39) missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52,563,631 (GRCm39) missense probably damaging 1.00
R1422:Arhgap5 UTSW 12 52,566,297 (GRCm39) missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52,564,159 (GRCm39) missense probably benign
R1711:Arhgap5 UTSW 12 52,566,128 (GRCm39) missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52,589,376 (GRCm39) missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52,564,817 (GRCm39) missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52,565,930 (GRCm39) missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52,566,671 (GRCm39) missense probably benign 0.21
R3808:Arhgap5 UTSW 12 52,613,970 (GRCm39) missense possibly damaging 0.72
R4458:Arhgap5 UTSW 12 52,564,740 (GRCm39) missense probably benign
R4703:Arhgap5 UTSW 12 52,564,366 (GRCm39) missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52,565,860 (GRCm39) missense probably benign 0.00
R4737:Arhgap5 UTSW 12 52,565,860 (GRCm39) missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52,565,860 (GRCm39) missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52,604,275 (GRCm39) missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52,565,486 (GRCm39) missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52,565,992 (GRCm39) missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52,566,695 (GRCm39) missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52,566,562 (GRCm39) missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52,566,369 (GRCm39) missense probably benign
R5911:Arhgap5 UTSW 12 52,565,525 (GRCm39) missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52,564,446 (GRCm39) missense probably benign 0.11
R6887:Arhgap5 UTSW 12 52,565,927 (GRCm39) missense probably benign
R6988:Arhgap5 UTSW 12 52,564,908 (GRCm39) missense possibly damaging 0.94
R7009:Arhgap5 UTSW 12 52,566,422 (GRCm39) missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52,565,109 (GRCm39) missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52,564,159 (GRCm39) missense probably benign
R7310:Arhgap5 UTSW 12 52,589,270 (GRCm39) critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52,564,481 (GRCm39) missense possibly damaging 0.64
R7375:Arhgap5 UTSW 12 52,563,365 (GRCm39) nonsense probably null
R7421:Arhgap5 UTSW 12 52,564,783 (GRCm39) missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52,563,739 (GRCm39) missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52,565,480 (GRCm39) missense possibly damaging 0.78
R8079:Arhgap5 UTSW 12 52,613,988 (GRCm39) missense probably benign
R8241:Arhgap5 UTSW 12 52,565,098 (GRCm39) missense probably benign 0.00
R8419:Arhgap5 UTSW 12 52,565,572 (GRCm39) missense probably damaging 1.00
R9138:Arhgap5 UTSW 12 52,609,146 (GRCm39) missense probably benign 0.05
X0018:Arhgap5 UTSW 12 52,565,180 (GRCm39) missense probably damaging 1.00
Z1176:Arhgap5 UTSW 12 52,565,246 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCTTTCTTTGGCAATGAGGGAACTAC -3'
(R):5'- TTTCTGCTGACTGCAATTTTGAGGC -3'

Sequencing Primer
(F):5'- CAATGAGGGAACTACAAAGAACC -3'
(R):5'- GTCTGGTCATCAATGAACTCTG -3'
Posted On 2013-04-24