Incidental Mutation 'R0356:Cenpj'
ID29842
Institutional Source Beutler Lab
Gene Symbol Cenpj
Ensembl Gene ENSMUSG00000064128
Gene Namecentromere protein J
Synonyms4932437H03Rik, Sas4
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56526761-56575425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56549496 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 917 (E917G)
Ref Sequence ENSEMBL: ENSMUSP00000153013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000225951]
Predicted Effect probably damaging
Transcript: ENSMUST00000065302
AA Change: E917G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128
AA Change: E917G

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
coiled coil region 140 185 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
low complexity region 860 871 N/A INTRINSIC
coiled coil region 899 1046 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Pfam:Tcp10_C 1167 1342 5.1e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225951
AA Change: E917G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000229861
AA Change: E208G
Meta Mutation Damage Score 0.1413 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Daxx T A 17: 33,913,893 V627D probably benign Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Cenpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cenpj APN 14 56553030 missense probably benign 0.04
IGL00969:Cenpj APN 14 56564963 missense possibly damaging 0.68
IGL01152:Cenpj APN 14 56552300 missense probably benign 0.01
IGL01475:Cenpj APN 14 56565045 missense possibly damaging 0.80
IGL01548:Cenpj APN 14 56532319 missense probably benign 0.00
IGL01893:Cenpj APN 14 56553474 missense probably damaging 1.00
IGL02647:Cenpj APN 14 56530079 missense probably damaging 0.99
IGL02683:Cenpj APN 14 56552952 missense possibly damaging 0.88
IGL02691:Cenpj APN 14 56552090 missense probably benign 0.28
IGL03008:Cenpj APN 14 56526949 missense probably benign 0.39
R0206:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0208:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0942:Cenpj UTSW 14 56555209 unclassified probably benign
R1392:Cenpj UTSW 14 56534854 splice site probably benign
R1564:Cenpj UTSW 14 56552066 missense probably benign 0.43
R1671:Cenpj UTSW 14 56565045 missense probably damaging 0.99
R1889:Cenpj UTSW 14 56558725 missense probably benign 0.43
R2059:Cenpj UTSW 14 56563955 missense possibly damaging 0.94
R2140:Cenpj UTSW 14 56526932 missense probably damaging 1.00
R2509:Cenpj UTSW 14 56532237 missense probably null 0.98
R2866:Cenpj UTSW 14 56552180 missense probably benign 0.01
R3813:Cenpj UTSW 14 56553222 missense probably benign 0.05
R4620:Cenpj UTSW 14 56535454 missense probably damaging 0.99
R4670:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4671:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4765:Cenpj UTSW 14 56549545 nonsense probably null
R4915:Cenpj UTSW 14 56553718 missense probably damaging 0.98
R4930:Cenpj UTSW 14 56534781 nonsense probably null
R5088:Cenpj UTSW 14 56553691 missense probably damaging 1.00
R5523:Cenpj UTSW 14 56552423 missense probably benign 0.00
R5527:Cenpj UTSW 14 56526983 missense probably damaging 1.00
R5717:Cenpj UTSW 14 56553521 frame shift probably null
R5944:Cenpj UTSW 14 56553658 critical splice donor site probably null
R5975:Cenpj UTSW 14 56564066 missense possibly damaging 0.92
R6019:Cenpj UTSW 14 56534815 missense probably benign 0.01
R6291:Cenpj UTSW 14 56551976 missense probably benign 0.01
R6948:Cenpj UTSW 14 56553226 missense probably damaging 0.96
R7212:Cenpj UTSW 14 56552652 missense probably benign 0.00
R7461:Cenpj UTSW 14 56527044 nonsense probably null
R7613:Cenpj UTSW 14 56527044 nonsense probably null
R7634:Cenpj UTSW 14 56542800 missense probably benign 0.00
R7837:Cenpj UTSW 14 56558728 missense probably benign 0.02
RF007:Cenpj UTSW 14 56530048 critical splice donor site probably null
Z1177:Cenpj UTSW 14 56552879 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGGACTTCAGCCTTCCAGCTTC -3'
(R):5'- TGGTTCCGTGGCAAACCTTCTTG -3'

Sequencing Primer
(F):5'- aacttctgatgctcctgcc -3'
(R):5'- GCAAACCTTCTTGGCTGTTG -3'
Posted On2013-04-24