Incidental Mutation 'R0356:Daxx'
ID29845
Institutional Source Beutler Lab
Gene Symbol Daxx
Ensembl Gene ENSMUSG00000002307
Gene NameFas death domain-associated protein
Synonyms
MMRRC Submission 038562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0356 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33909414-33915589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33913893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 627 (V627D)
Ref Sequence ENSEMBL: ENSMUSP00000133552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000173028] [ENSMUST00000173626] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079421
AA Change: V665D
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307
AA Change: V665D

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170075
AA Change: V665D
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307
AA Change: V665D

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172526
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172859
Predicted Effect probably benign
Transcript: ENSMUST00000173028
SMART Domains Protein: ENSMUSP00000133319
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 137 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably benign
Transcript: ENSMUST00000173626
SMART Domains Protein: ENSMUSP00000133303
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 167 6.8e-74 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174146
AA Change: V665D
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307
AA Change: V665D

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174321
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174467
Predicted Effect probably benign
Transcript: ENSMUST00000174541
AA Change: V627D

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307
AA Change: V627D

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene display extensive apoptosis and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,365 V186E possibly damaging Het
9430097D07Rik T C 2: 32,574,406 probably benign Het
Adgrg6 C T 10: 14,426,898 V924M possibly damaging Het
Akap2 C A 4: 57,855,628 T360K possibly damaging Het
Anxa9 A G 3: 95,308,076 probably benign Het
Ap3d1 G T 10: 80,727,978 S122R probably damaging Het
Arhgap5 T C 12: 52,516,308 S21P probably damaging Het
Atp13a5 A G 16: 29,348,755 probably benign Het
AU040320 A T 4: 126,837,362 D618V probably damaging Het
Cbfa2t2 T A 2: 154,531,349 D475E probably benign Het
Ccdc62 G A 5: 123,954,748 V599I probably benign Het
Cenpj T C 14: 56,549,496 E917G probably damaging Het
Cog5 T C 12: 31,837,181 probably benign Het
Col9a1 T A 1: 24,185,247 L170* probably null Het
Dnah9 A G 11: 66,130,562 probably null Het
Drg2 T A 11: 60,461,581 V203E probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fer1l4 T C 2: 156,024,010 Y1586C probably damaging Het
Gp6 A T 7: 4,370,142 probably benign Het
Hhip T C 8: 79,997,492 I374V probably benign Het
Hspa12b G T 2: 131,144,799 V547L possibly damaging Het
Iars G A 13: 49,703,233 V321I probably benign Het
Itga8 T C 2: 12,182,721 M716V possibly damaging Het
Lcn5 T C 2: 25,660,693 I131T probably damaging Het
Mki67 G A 7: 135,704,406 T614M probably benign Het
Mmp3 G A 9: 7,451,768 E369K probably benign Het
Myt1l A G 12: 29,811,501 D94G unknown Het
Neil1 T C 9: 57,146,896 I47V possibly damaging Het
Nr5a2 T C 1: 136,845,692 N424S possibly damaging Het
Olfr1477 A G 19: 13,503,077 T245A possibly damaging Het
Olfr380 A T 11: 73,454,080 I44N possibly damaging Het
Olfr561 A T 7: 102,775,079 D185V probably damaging Het
Olfr857 G T 9: 19,713,447 G207C probably damaging Het
Pde8b G T 13: 95,046,454 N265K probably damaging Het
Prpf40b T C 15: 99,305,199 probably null Het
Samd9l T C 6: 3,375,107 D718G possibly damaging Het
Sirpb1c T C 3: 15,833,145 N175D possibly damaging Het
Srgap1 A T 10: 121,855,536 probably null Het
Tgm5 T A 2: 121,053,574 T313S probably damaging Het
Tigar A G 6: 127,091,182 probably null Het
Tmprss11b A G 5: 86,660,467 *417Q probably null Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Ttll11 T C 2: 35,902,676 D385G possibly damaging Het
Zfp426 T C 9: 20,471,245 T135A probably benign Het
Other mutations in Daxx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Daxx APN 17 33911607 nonsense probably null
IGL01066:Daxx APN 17 33913893 missense probably benign 0.43
IGL01622:Daxx APN 17 33913480 missense probably benign
IGL02245:Daxx APN 17 33912377 splice site probably benign
IGL02432:Daxx APN 17 33912337 missense probably benign 0.31
IGL02484:Daxx APN 17 33912242 missense probably damaging 1.00
IGL02992:Daxx APN 17 33911748 missense probably damaging 1.00
R0302:Daxx UTSW 17 33913620 missense probably damaging 1.00
R0437:Daxx UTSW 17 33913624 missense probably benign 0.00
R0635:Daxx UTSW 17 33912644 missense probably benign 0.00
R0932:Daxx UTSW 17 33910661 missense probably damaging 1.00
R1498:Daxx UTSW 17 33912253 missense probably damaging 1.00
R1785:Daxx UTSW 17 33911842 missense probably damaging 1.00
R1996:Daxx UTSW 17 33913611 missense possibly damaging 0.89
R2367:Daxx UTSW 17 33911847 missense probably benign 0.38
R4320:Daxx UTSW 17 33911419 missense probably damaging 1.00
R4321:Daxx UTSW 17 33911406 missense possibly damaging 0.94
R5055:Daxx UTSW 17 33912160 missense probably benign 0.01
R5546:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912659 small deletion probably benign
R5591:Daxx UTSW 17 33911688 missense probably damaging 1.00
R6317:Daxx UTSW 17 33911975 missense probably damaging 1.00
R6362:Daxx UTSW 17 33911364 missense probably damaging 1.00
R6493:Daxx UTSW 17 33912371 critical splice donor site probably null
R7100:Daxx UTSW 17 33911442 missense probably damaging 1.00
R7176:Daxx UTSW 17 33913318 missense unknown
R7310:Daxx UTSW 17 33910461 missense possibly damaging 0.70
R7418:Daxx UTSW 17 33910605 missense probably benign 0.05
R7476:Daxx UTSW 17 33911281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAATGAGAGTCCCACATCGCC -3'
(R):5'- AATACACTGCCGGAGAGACTGAGC -3'

Sequencing Primer
(F):5'- TCTCACACTTGGAGAGATGC -3'
(R):5'- AGACTGAGCCTGGGGTG -3'
Posted On2013-04-24