Incidental Mutation 'R0356:Daxx'
ID 29845
Institutional Source Beutler Lab
Gene Symbol Daxx
Ensembl Gene ENSMUSG00000002307
Gene Name Fas death domain-associated protein
Synonyms
MMRRC Submission 038562-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0356 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34128388-34134564 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34132867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 627 (V627D)
Ref Sequence ENSEMBL: ENSMUSP00000133552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000174146] [ENSMUST00000174541] [ENSMUST00000173028] [ENSMUST00000174463] [ENSMUST00000173626]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079421
AA Change: V665D
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307
AA Change: V665D

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170075
AA Change: V665D
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307
AA Change: V665D

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172526
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172859
Predicted Effect unknown
Transcript: ENSMUST00000174146
AA Change: V665D
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307
AA Change: V665D

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably benign
Transcript: ENSMUST00000174541
AA Change: V627D

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307
AA Change: V627D

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174467
Predicted Effect probably benign
Transcript: ENSMUST00000173028
SMART Domains Protein: ENSMUSP00000133319
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 137 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173626
SMART Domains Protein: ENSMUSP00000133303
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 167 6.8e-74 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.6%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene display extensive apoptosis and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,464,418 (GRCm39) probably benign Het
Adgrg6 C T 10: 14,302,642 (GRCm39) V924M possibly damaging Het
Anxa9 A G 3: 95,215,387 (GRCm39) probably benign Het
Ap3d1 G T 10: 80,563,812 (GRCm39) S122R probably damaging Het
Arhgap5 T C 12: 52,563,091 (GRCm39) S21P probably damaging Het
Atp13a5 A G 16: 29,167,573 (GRCm39) probably benign Het
AU040320 A T 4: 126,731,155 (GRCm39) D618V probably damaging Het
Cbfa2t2 T A 2: 154,373,269 (GRCm39) D475E probably benign Het
Ccdc202 T A 14: 96,119,801 (GRCm39) V186E possibly damaging Het
Ccdc62 G A 5: 124,092,811 (GRCm39) V599I probably benign Het
Cenpj T C 14: 56,786,953 (GRCm39) E917G probably damaging Het
Cog5 T C 12: 31,887,180 (GRCm39) probably benign Het
Col9a1 T A 1: 24,224,328 (GRCm39) L170* probably null Het
Dnah9 A G 11: 66,021,388 (GRCm39) probably null Het
Drg2 T A 11: 60,352,407 (GRCm39) V203E probably damaging Het
Fbxl17 G A 17: 63,663,846 (GRCm39) R67C probably damaging Het
Fer1l4 T C 2: 155,865,930 (GRCm39) Y1586C probably damaging Het
Gp6 A T 7: 4,373,141 (GRCm39) probably benign Het
Hhip T C 8: 80,724,121 (GRCm39) I374V probably benign Het
Hspa12b G T 2: 130,986,719 (GRCm39) V547L possibly damaging Het
Iars1 G A 13: 49,856,709 (GRCm39) V321I probably benign Het
Itga8 T C 2: 12,187,532 (GRCm39) M716V possibly damaging Het
Lcn5 T C 2: 25,550,705 (GRCm39) I131T probably damaging Het
Mki67 G A 7: 135,306,135 (GRCm39) T614M probably benign Het
Mmp3 G A 9: 7,451,768 (GRCm39) E369K probably benign Het
Myt1l A G 12: 29,861,500 (GRCm39) D94G unknown Het
Neil1 T C 9: 57,054,180 (GRCm39) I47V possibly damaging Het
Nr5a2 T C 1: 136,773,430 (GRCm39) N424S possibly damaging Het
Or1e21 A T 11: 73,344,906 (GRCm39) I44N possibly damaging Het
Or51f5 A T 7: 102,424,286 (GRCm39) D185V probably damaging Het
Or5b120 A G 19: 13,480,441 (GRCm39) T245A possibly damaging Het
Or7e166 G T 9: 19,624,743 (GRCm39) G207C probably damaging Het
Pakap C A 4: 57,855,628 (GRCm39) T360K possibly damaging Het
Pde8b G T 13: 95,182,962 (GRCm39) N265K probably damaging Het
Prpf40b T C 15: 99,203,080 (GRCm39) probably null Het
Samd9l T C 6: 3,375,107 (GRCm39) D718G possibly damaging Het
Sirpb1c T C 3: 15,887,309 (GRCm39) N175D possibly damaging Het
Srgap1 A T 10: 121,691,441 (GRCm39) probably null Het
Tgm5 T A 2: 120,884,055 (GRCm39) T313S probably damaging Het
Tigar A G 6: 127,068,145 (GRCm39) probably null Het
Tmprss11b A G 5: 86,808,326 (GRCm39) *417Q probably null Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Ttll11 T C 2: 35,792,688 (GRCm39) D385G possibly damaging Het
Zfp426 T C 9: 20,382,541 (GRCm39) T135A probably benign Het
Other mutations in Daxx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Daxx APN 17 34,130,581 (GRCm39) nonsense probably null
IGL01066:Daxx APN 17 34,132,867 (GRCm39) missense probably benign 0.43
IGL01622:Daxx APN 17 34,132,454 (GRCm39) missense probably benign
IGL02245:Daxx APN 17 34,131,351 (GRCm39) splice site probably benign
IGL02432:Daxx APN 17 34,131,311 (GRCm39) missense probably benign 0.31
IGL02484:Daxx APN 17 34,131,216 (GRCm39) missense probably damaging 1.00
IGL02992:Daxx APN 17 34,130,722 (GRCm39) missense probably damaging 1.00
R0302:Daxx UTSW 17 34,132,594 (GRCm39) missense probably damaging 1.00
R0437:Daxx UTSW 17 34,132,598 (GRCm39) missense probably benign 0.00
R0635:Daxx UTSW 17 34,131,618 (GRCm39) missense probably benign 0.00
R0932:Daxx UTSW 17 34,129,635 (GRCm39) missense probably damaging 1.00
R1498:Daxx UTSW 17 34,131,227 (GRCm39) missense probably damaging 1.00
R1785:Daxx UTSW 17 34,130,816 (GRCm39) missense probably damaging 1.00
R1996:Daxx UTSW 17 34,132,585 (GRCm39) missense possibly damaging 0.89
R2367:Daxx UTSW 17 34,130,821 (GRCm39) missense probably benign 0.38
R4320:Daxx UTSW 17 34,130,393 (GRCm39) missense probably damaging 1.00
R4321:Daxx UTSW 17 34,130,380 (GRCm39) missense possibly damaging 0.94
R5055:Daxx UTSW 17 34,131,134 (GRCm39) missense probably benign 0.01
R5546:Daxx UTSW 17 34,131,615 (GRCm39) small deletion probably benign
R5547:Daxx UTSW 17 34,131,633 (GRCm39) small deletion probably benign
R5547:Daxx UTSW 17 34,131,615 (GRCm39) small deletion probably benign
R5591:Daxx UTSW 17 34,130,662 (GRCm39) missense probably damaging 1.00
R6317:Daxx UTSW 17 34,130,949 (GRCm39) missense probably damaging 1.00
R6362:Daxx UTSW 17 34,130,338 (GRCm39) missense probably damaging 1.00
R6493:Daxx UTSW 17 34,131,345 (GRCm39) critical splice donor site probably null
R7100:Daxx UTSW 17 34,130,416 (GRCm39) missense probably damaging 1.00
R7176:Daxx UTSW 17 34,132,292 (GRCm39) missense unknown
R7310:Daxx UTSW 17 34,129,435 (GRCm39) missense possibly damaging 0.70
R7418:Daxx UTSW 17 34,129,579 (GRCm39) missense probably benign 0.05
R7476:Daxx UTSW 17 34,130,255 (GRCm39) missense probably damaging 1.00
R7955:Daxx UTSW 17 34,131,229 (GRCm39) nonsense probably null
R8369:Daxx UTSW 17 34,131,590 (GRCm39) missense probably damaging 1.00
R8748:Daxx UTSW 17 34,131,138 (GRCm39) missense probably damaging 1.00
R9447:Daxx UTSW 17 34,132,247 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAAATGAGAGTCCCACATCGCC -3'
(R):5'- AATACACTGCCGGAGAGACTGAGC -3'

Sequencing Primer
(F):5'- TCTCACACTTGGAGAGATGC -3'
(R):5'- AGACTGAGCCTGGGGTG -3'
Posted On 2013-04-24