Incidental Mutation 'R0357:Mogat1'
ID 29848
Institutional Source Beutler Lab
Gene Symbol Mogat1
Ensembl Gene ENSMUSG00000012187
Gene Name monoacylglycerol O-acyltransferase 1
Synonyms 1110064N14Rik, mDC2, 0610030A14Rik, Dgat2l1, MGAT1
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0357 (G1)
Quality Score 186
Status Validated
Chromosome 1
Chromosomal Location 78510991-78538173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78512040 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 27 (S27P)
Ref Sequence ENSEMBL: ENSMUSP00000123427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111] [ENSMUST00000170511]
AlphaFold Q91ZV4
Predicted Effect probably benign
Transcript: ENSMUST00000012331
AA Change: S27P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187
AA Change: S27P

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113524
AA Change: S27P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187
AA Change: S27P

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134947
AA Change: S27P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187
AA Change: S27P

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149732
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152111
AA Change: S27P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187
AA Change: S27P

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170511
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerols, the precursor of physiologically important lipids such as triacylglycerol and phospholipids (Yen et al., 2002 [PubMed 12077311]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight in female, but not, male mice and does not ameliorate hepatic steatosis in lipodystrophic or obese mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Mogat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1716:Mogat1 UTSW 1 78538044 missense probably benign 0.01
R3799:Mogat1 UTSW 1 78529138 missense probably benign 0.00
R4168:Mogat1 UTSW 1 78512035 missense possibly damaging 0.77
R5485:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R5929:Mogat1 UTSW 1 78523733 missense probably benign 0.00
R6640:Mogat1 UTSW 1 78523774 missense probably damaging 0.99
R6841:Mogat1 UTSW 1 78522859 missense probably damaging 1.00
R7842:Mogat1 UTSW 1 78522865 critical splice donor site probably null
R8179:Mogat1 UTSW 1 78527618 missense possibly damaging 0.58
R9708:Mogat1 UTSW 1 78511996 missense probably damaging 0.99
R9788:Mogat1 UTSW 1 78522705 missense probably benign 0.00
Z1177:Mogat1 UTSW 1 78529253 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCTAGGCGGTCTATCAGATGAAC -3'
(R):5'- agagagggagagGAATCCAAAGCAG -3'

Sequencing Primer
(F):5'- AAGCTGTGATTAGTGATCCCCAG -3'
(R):5'- gagGAATCCAAAGCAGGGAGTC -3'
Posted On 2013-04-24