Incidental Mutation 'R0357:Epb41l5'
ID 29849
Institutional Source Beutler Lab
Gene Symbol Epb41l5
Ensembl Gene ENSMUSG00000026383
Gene Name erythrocyte membrane protein band 4.1 like 5
Synonyms E230025E14Rik, 1700030C16Rik, Epb4.1l5, NBL5, Lulu1
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 119545037-119649000 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119609204 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 319 (H319R)
Ref Sequence ENSEMBL: ENSMUSP00000140227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027632] [ENSMUST00000052404] [ENSMUST00000163147] [ENSMUST00000191046]
AlphaFold Q8BGS1
Predicted Effect probably damaging
Transcript: ENSMUST00000027632
AA Change: H319R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027632
Gene: ENSMUSG00000026383
AA Change: H319R

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052404
AA Change: H319R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058966
Gene: ENSMUSG00000026383
AA Change: H319R

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
coiled coil region 482 512 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163147
AA Change: H319R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128374
Gene: ENSMUSG00000026383
AA Change: H319R

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 420 429 N/A INTRINSIC
coiled coil region 490 520 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191046
AA Change: H319R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140227
Gene: ENSMUSG00000026383
AA Change: H319R

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Meta Mutation Damage Score 0.7794 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a number of different mutations exhibit prenatal lethality and mesodermal and epithelial-mesenchymal transition defects during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Epb41l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Epb41l5 APN 1 119567847 missense probably benign 0.03
IGL01983:Epb41l5 APN 1 119579084 splice site probably benign
IGL02085:Epb41l5 APN 1 119572856 missense probably benign
IGL02834:Epb41l5 APN 1 119623955 missense probably benign 0.22
IGL02975:Epb41l5 APN 1 119579081 splice site probably benign
IGL03001:Epb41l5 APN 1 119617644 missense probably damaging 1.00
IGL03331:Epb41l5 APN 1 119617419 missense probably damaging 1.00
R0096:Epb41l5 UTSW 1 119623911 splice site probably benign
R0124:Epb41l5 UTSW 1 119633640 nonsense probably null
R0128:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0130:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0241:Epb41l5 UTSW 1 119567779 splice site probably null
R0624:Epb41l5 UTSW 1 119623958 missense probably damaging 1.00
R0711:Epb41l5 UTSW 1 119623911 splice site probably benign
R0848:Epb41l5 UTSW 1 119549954 missense probably benign 0.01
R1340:Epb41l5 UTSW 1 119549131 makesense probably null
R1401:Epb41l5 UTSW 1 119578904 splice site probably benign
R1416:Epb41l5 UTSW 1 119549876 splice site probably benign
R1452:Epb41l5 UTSW 1 119549166 missense probably damaging 1.00
R1646:Epb41l5 UTSW 1 119550022 splice site probably benign
R1889:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R1895:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R3082:Epb41l5 UTSW 1 119609262 missense probably damaging 1.00
R3742:Epb41l5 UTSW 1 119605243 missense probably benign
R4194:Epb41l5 UTSW 1 119608093 missense probably damaging 1.00
R4787:Epb41l5 UTSW 1 119595995 missense probably benign 0.00
R4983:Epb41l5 UTSW 1 119555071 missense probably benign 0.00
R6825:Epb41l5 UTSW 1 119620201 missense possibly damaging 0.54
R6943:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R6944:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R7334:Epb41l5 UTSW 1 119623949 missense probably damaging 1.00
R8553:Epb41l5 UTSW 1 119549941 missense possibly damaging 0.88
R8904:Epb41l5 UTSW 1 119620206 missense probably damaging 1.00
R8955:Epb41l5 UTSW 1 119642562 missense probably damaging 1.00
R9147:Epb41l5 UTSW 1 119642589 missense probably damaging 1.00
R9258:Epb41l5 UTSW 1 119578971 missense probably benign
R9351:Epb41l5 UTSW 1 119549909 missense probably benign 0.01
R9366:Epb41l5 UTSW 1 119620718 missense probably damaging 1.00
R9370:Epb41l5 UTSW 1 119633582 missense probably damaging 1.00
R9680:Epb41l5 UTSW 1 119608074 missense probably damaging 1.00
R9779:Epb41l5 UTSW 1 119617363 critical splice donor site probably null
Z1177:Epb41l5 UTSW 1 119609211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAACTGGCCTTCAGCCACAGTA -3'
(R):5'- AGGACCTTGGAAAGTGTCAGGTGTA -3'

Sequencing Primer
(F):5'- CTGTATGAGATAAACCTGTCAGATTG -3'
(R):5'- gccatctctccagcacc -3'
Posted On 2013-04-24