Incidental Mutation 'R0357:Olfr429'
ID 29850
Institutional Source Beutler Lab
Gene Symbol Olfr429
Ensembl Gene ENSMUSG00000049528
Gene Name olfactory receptor 429
Synonyms MOR105-1, GA_x6K02T2P20D-21090094-21089156
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 174084331-174091343 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 174089109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000149257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060693] [ENSMUST00000216346]
AlphaFold Q7TRW1
Predicted Effect possibly damaging
Transcript: ENSMUST00000060693
AA Change: V23A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051323
Gene: ENSMUSG00000049528
AA Change: V23A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-65 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193320
AA Change: V23A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142323
Gene: ENSMUSG00000049528
AA Change: V23A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:7tm_1 41 290 8.9e-31 PFAM
Pfam:7tm_4 139 283 6.7e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216346
AA Change: V23A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1262 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Olfr429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Olfr429 APN 1 174089556 missense probably damaging 1.00
IGL01868:Olfr429 APN 1 174089370 missense possibly damaging 0.83
IGL01972:Olfr429 APN 1 174089421 missense probably damaging 0.99
IGL02412:Olfr429 APN 1 174089243 missense probably benign 0.00
IGL02628:Olfr429 APN 1 174089190 missense probably benign
IGL02861:Olfr429 APN 1 174089036 utr 5 prime probably benign
IGL03404:Olfr429 APN 1 174089898 missense probably damaging 1.00
R0267:Olfr429 UTSW 1 174089166 missense probably damaging 1.00
R1499:Olfr429 UTSW 1 174089247 nonsense probably null
R2051:Olfr429 UTSW 1 174089219 missense possibly damaging 0.95
R4706:Olfr429 UTSW 1 174089702 missense probably damaging 1.00
R4820:Olfr429 UTSW 1 174089176 missense possibly damaging 0.95
R5439:Olfr429 UTSW 1 174089975 missense probably benign 0.01
R5538:Olfr429 UTSW 1 174089978 makesense probably null
R5907:Olfr429 UTSW 1 174089219 missense probably benign 0.08
R6932:Olfr429 UTSW 1 174089750 missense probably damaging 0.96
R7808:Olfr429 UTSW 1 174089851 nonsense probably null
R8040:Olfr429 UTSW 1 174089157 missense possibly damaging 0.68
R8467:Olfr429 UTSW 1 174089441 missense probably benign 0.00
R9124:Olfr429 UTSW 1 174089775 missense probably damaging 1.00
R9797:Olfr429 UTSW 1 174089790 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGGCAGTTTCCCTGGAAGCAATG -3'
(R):5'- TGTAGCCCAGCTCCAAGAAGGAAAG -3'

Sequencing Primer
(F):5'- GGAATTGCCTGCTTCTCAAAG -3'
(R):5'- GGATGCTGACAAATCTGTACATGG -3'
Posted On 2013-04-24