Incidental Mutation 'R0357:Olfr424'
ID 29851
Institutional Source Beutler Lab
Gene Symbol Olfr424
Ensembl Gene ENSMUSG00000051528
Gene Name olfactory receptor 424
Synonyms MOR105-2, GA_x6K02T2P20D-21025190-21024243
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 174131517-174138257 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 174137299 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 185 (L185*)
Ref Sequence ENSEMBL: ENSMUSP00000150840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053941] [ENSMUST00000214751]
AlphaFold E9Q0Q2
Predicted Effect probably null
Transcript: ENSMUST00000053941
AA Change: L185*
SMART Domains Protein: ENSMUSP00000054305
Gene: ENSMUSG00000051528
AA Change: L185*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-63 PFAM
Pfam:7tm_1 41 289 1.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192471
Predicted Effect probably null
Transcript: ENSMUST00000214751
AA Change: L185*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218625
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Olfr424
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Olfr424 APN 1 174137113 missense possibly damaging 0.46
IGL01651:Olfr424 APN 1 174137341 missense probably damaging 0.96
R0194:Olfr424 UTSW 1 174136761 missense probably benign 0.04
R0732:Olfr424 UTSW 1 174137415 missense possibly damaging 0.85
R1103:Olfr424 UTSW 1 174136891 missense probably benign 0.07
R1623:Olfr424 UTSW 1 174137317 missense probably damaging 0.98
R1829:Olfr424 UTSW 1 174137194 missense probably benign 0.12
R6617:Olfr424 UTSW 1 174137248 missense probably damaging 1.00
R7060:Olfr424 UTSW 1 174136810 missense probably benign 0.00
R7203:Olfr424 UTSW 1 174137114 nonsense probably null
R7625:Olfr424 UTSW 1 174137167 missense probably benign 0.13
R7994:Olfr424 UTSW 1 174136707 start gained probably benign
R8035:Olfr424 UTSW 1 174136924 missense probably damaging 1.00
R8127:Olfr424 UTSW 1 174137589 missense probably damaging 1.00
R8802:Olfr424 UTSW 1 174137050 missense probably damaging 1.00
R9102:Olfr424 UTSW 1 174136756 missense
R9296:Olfr424 UTSW 1 174137269 missense probably benign 0.02
R9374:Olfr424 UTSW 1 174137319 missense probably benign 0.34
R9551:Olfr424 UTSW 1 174137319 missense probably benign 0.34
R9552:Olfr424 UTSW 1 174137319 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GATGGATACCCGTCTTCACAACCC -3'
(R):5'- GCAGCACAAGTAGAGAAAGCCTTCC -3'

Sequencing Primer
(F):5'- CCATTCACTTGGAAATTCAGAGGG -3'
(R):5'- CGACGGCCTTCACCAGAG -3'
Posted On 2013-04-24