Mutagenetix > Incidental Mutation

Incidental Mutation 'R0357:Vmn2r2'

29858

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r2

Ensembl Gene

ENSMUSG00000043897

Gene Name

vomeronasal 2, receptor 2

Synonyms

MMRRC Submission

038563-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R0357 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64116432-64140543 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 64133899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000135110 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]

AlphaFold

L7N2E9

Predicted Effect

probably null
Transcript: ENSMUST00000077958

SMART Domains

Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	416	4.5e-80	PFAM
Pfam:NCD3G	458	511	8.3e-18	PFAM
Pfam:7tm_3	542	779	1.3e-75	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000177151

SMART Domains

Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	83	500	1.6e-84	PFAM
Pfam:NCD3G	542	595	2.6e-17	PFAM
Pfam:7tm_3	628	862	1.9e-47	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 89.3%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,179,209	S169P	possibly damaging	Het
4930402H24Rik	A	T	2: 130,712,946		probably benign	Het
4931428F04Rik	A	T	8: 105,285,067	V222E	probably damaging	Het
4932431P20Rik	A	T	7: 29,535,582		noncoding transcript	Het
9230019H11Rik	A	T	10: 3,120,307		noncoding transcript	Het
9230019H11Rik	A	G	10: 3,125,788		noncoding transcript	Het
Abcf2	T	C	5: 24,573,465	K232E	probably benign	Het
AI837181	C	T	19: 5,426,703	T298I	possibly damaging	Het
Alox12	T	C	11: 70,242,536	Y614C	probably damaging	Het
Amn	A	T	12: 111,274,141		probably null	Het
Ankrd33b	A	G	15: 31,305,126	S121P	probably benign	Het
Aox1	A	G	1: 58,092,516	Y1028C	probably damaging	Het
Asph	C	A	4: 9,453,314	R736L	probably benign	Het
Atp2a3	G	A	11: 72,970,931		probably null	Het
Cables2	T	C	2: 180,262,232		probably benign	Het
Catsperg2	A	T	7: 29,714,901	Y360N	possibly damaging	Het
Ccdc129	T	A	6: 55,968,034	M580K	probably benign	Het
Cd163l1	T	G	7: 140,227,895	C660G	probably damaging	Het
Cdh4	T	C	2: 179,847,340	S282P	probably damaging	Het
Col5a3	C	T	9: 20,807,768		probably benign	Het
Ctso	A	T	3: 81,951,543		probably benign	Het
Cyp4f13	A	T	17: 32,932,651	Y125*	probably null	Het
Dapk1	T	A	13: 60,729,558	L537*	probably null	Het
Ddit4l	G	A	3: 137,626,185	R104Q	probably benign	Het
Def6	C	T	17: 28,223,935	H322Y	probably damaging	Het
Dnah6	T	C	6: 73,188,359	N588D	probably benign	Het
Dzip1	T	A	14: 118,909,538	I320F	probably damaging	Het
Epb41l5	T	C	1: 119,609,204	H319R	probably damaging	Het
Erc2	A	G	14: 27,777,022	E285G	probably damaging	Het
Fam109b	C	T	15: 82,343,316	A12V	probably damaging	Het
Fat4	G	A	3: 38,891,227	G1423E	probably damaging	Het
Foxp2	C	T	6: 15,409,840	P480S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,133	A126T	probably damaging	Het
Gbp5	G	A	3: 142,505,411	D301N	probably benign	Het
Gm10360	T	C	6: 70,424,313		noncoding transcript	Het
Gm6471	T	A	7: 142,833,867		noncoding transcript	Het
Gm8674	T	A	13: 49,902,113		noncoding transcript	Het
Hist2h2bb	A	C	3: 96,269,788	K13Q	probably null	Het
Ift172	A	G	5: 31,257,900	S1322P	possibly damaging	Het
Ift80	A	T	3: 68,914,653	Y686*	probably null	Het
Insrr	A	C	3: 87,808,646		probably null	Het
Krt83	C	T	15: 101,487,019	V399M	probably benign	Het
Macf1	T	C	4: 123,457,983	N3708S	probably damaging	Het
Mogat1	T	C	1: 78,512,040	S27P	probably benign	Het
Mrgpra4	A	T	7: 47,981,826	M9K	probably benign	Het
Mtus1	A	T	8: 41,083,526	S384R	possibly damaging	Het
Myo1a	T	A	10: 127,710,902	M306K	probably benign	Het
Noxa1	G	T	2: 25,085,850	D403E	probably damaging	Het
Ogdhl	T	C	14: 32,346,458	V884A	possibly damaging	Het
Olfr1335	A	C	4: 118,809,417	L149R	probably damaging	Het
Olfr1392	A	G	11: 49,293,786	N155S	probably damaging	Het
Olfr424	T	A	1: 174,137,299	L185*	probably null	Het
Olfr429	T	C	1: 174,089,109	V23A	possibly damaging	Het
Paxip1	G	A	5: 27,758,623		probably benign	Het
Paxx	T	A	2: 25,460,067	E145D	probably damaging	Het
Pde4d	T	C	13: 109,951,268	V560A	possibly damaging	Het
Plxnd1	C	T	6: 115,969,460	V847M	probably benign	Het
Polk	T	A	13: 96,504,597	M151L	probably damaging	Het
Ptprq	C	T	10: 107,686,199		probably benign	Het
Pum2	A	G	12: 8,721,785	Q371R	possibly damaging	Het
Reln	G	A	5: 21,950,822	A2224V	probably damaging	Het
Shroom1	A	G	11: 53,465,208	T362A	probably damaging	Het
Smarcd2	A	G	11: 106,267,332		probably null	Het
Spg11	A	C	2: 122,066,232		probably benign	Het
Tcaf3	T	A	6: 42,589,827	Y776F	probably damaging	Het
Thada	A	G	17: 84,230,936	V1548A	probably damaging	Het
Trpv2	C	T	11: 62,590,304	P410S	probably damaging	Het
Ube2u	G	T	4: 100,481,654	E39*	probably null	Het
Vmn2r24	TCC	TC	6: 123,815,410		probably null	Het
Zfp110	A	G	7: 12,836,375	Y43C	probably damaging	Het
Zfp605	A	G	5: 110,124,379	T55A	probably benign	Het

Other mutations in Vmn2r2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Vmn2r2	APN	3	64133898	splice site	probably benign
IGL00980:Vmn2r2	APN	3	64117180	missense	probably benign	0.11
IGL01389:Vmn2r2	APN	3	64117009	missense	probably damaging	0.97
IGL01804:Vmn2r2	APN	3	64134256	missense	possibly damaging	0.91
IGL02750:Vmn2r2	APN	3	64117402	missense	probably damaging	1.00
IGL02829:Vmn2r2	APN	3	64118751	splice site	probably benign
IGL03036:Vmn2r2	APN	3	64116900	missense	probably benign	0.01
IGL03174:Vmn2r2	APN	3	64117123	nonsense	probably null
PIT4151001:Vmn2r2	UTSW	3	64116913	missense	possibly damaging	0.67
R0029:Vmn2r2	UTSW	3	64116944	missense	probably benign	0.00
R0310:Vmn2r2	UTSW	3	64134618	missense	probably damaging	1.00
R0637:Vmn2r2	UTSW	3	64126578	missense	probably benign	0.00
R1626:Vmn2r2	UTSW	3	64134500	missense	possibly damaging	0.61
R1662:Vmn2r2	UTSW	3	64117130	missense	probably benign	0.00
R1710:Vmn2r2	UTSW	3	64117399	missense	probably benign	0.19
R1797:Vmn2r2	UTSW	3	64134707	missense	probably benign	0.00
R1862:Vmn2r2	UTSW	3	64134521	missense	possibly damaging	0.79
R1971:Vmn2r2	UTSW	3	64126700	missense	probably damaging	1.00
R2051:Vmn2r2	UTSW	3	64117345	missense	possibly damaging	0.77
R2099:Vmn2r2	UTSW	3	64117053	missense	probably damaging	1.00
R2275:Vmn2r2	UTSW	3	64116509	missense	probably benign	0.00
R3078:Vmn2r2	UTSW	3	64134632	missense	probably benign	0.22
R3418:Vmn2r2	UTSW	3	64116899	missense	probably benign	0.00
R3419:Vmn2r2	UTSW	3	64116899	missense	probably benign	0.00
R3959:Vmn2r2	UTSW	3	64140526	missense	probably benign
R4230:Vmn2r2	UTSW	3	64134491	missense	probably benign	0.00
R4258:Vmn2r2	UTSW	3	64134697	missense	probably damaging	1.00
R4810:Vmn2r2	UTSW	3	64137462	missense	probably damaging	1.00
R4822:Vmn2r2	UTSW	3	64134539	missense	probably damaging	0.99
R4919:Vmn2r2	UTSW	3	64117157	missense	possibly damaging	0.56
R4925:Vmn2r2	UTSW	3	64137471	start codon destroyed	probably null	0.03
R4954:Vmn2r2	UTSW	3	64140484	missense	probably benign	0.00
R5071:Vmn2r2	UTSW	3	64116900	missense	probably benign	0.01
R5315:Vmn2r2	UTSW	3	64116956	missense	probably benign	0.37
R5450:Vmn2r2	UTSW	3	64126590	missense	probably benign
R5577:Vmn2r2	UTSW	3	64116995	missense	probably benign	0.00
R5595:Vmn2r2	UTSW	3	64126615	missense	possibly damaging	0.74
R5727:Vmn2r2	UTSW	3	64117187	missense	probably benign	0.41
R5810:Vmn2r2	UTSW	3	64117394	missense	probably damaging	1.00
R5919:Vmn2r2	UTSW	3	64137302	missense	probably benign	0.39
R6052:Vmn2r2	UTSW	3	64117361	missense	possibly damaging	0.56
R6084:Vmn2r2	UTSW	3	64117046	missense	probably benign	0.01
R6299:Vmn2r2	UTSW	3	64116653	nonsense	probably null
R6762:Vmn2r2	UTSW	3	64134449	missense	probably damaging	1.00
R6858:Vmn2r2	UTSW	3	64137494	missense	probably damaging	1.00
R6889:Vmn2r2	UTSW	3	64117267	missense	probably damaging	0.99
R6990:Vmn2r2	UTSW	3	64117187	missense	probably benign	0.02
R7195:Vmn2r2	UTSW	3	64116479	missense	probably benign	0.01
R7269:Vmn2r2	UTSW	3	64126577	missense	probably benign	0.32
R7699:Vmn2r2	UTSW	3	64117115	missense	possibly damaging	0.69
R7717:Vmn2r2	UTSW	3	64134598	missense	possibly damaging	0.95
R7798:Vmn2r2	UTSW	3	64134097	missense	possibly damaging	0.60
R7914:Vmn2r2	UTSW	3	64134105	missense	probably benign	0.20
R7974:Vmn2r2	UTSW	3	64117387	missense	probably damaging	0.99
R8394:Vmn2r2	UTSW	3	64137437	missense	probably damaging	1.00
R8478:Vmn2r2	UTSW	3	64116836	missense	possibly damaging	0.87
R8731:Vmn2r2	UTSW	3	64116983	missense	probably benign	0.16
R9035:Vmn2r2	UTSW	3	64116751	missense	probably damaging	1.00
R9182:Vmn2r2	UTSW	3	64137381	missense	probably damaging	1.00
R9225:Vmn2r2	UTSW	3	64126600	missense	probably benign	0.00
R9266:Vmn2r2	UTSW	3	64116636	missense	probably damaging	0.98
R9427:Vmn2r2	UTSW	3	64134524	missense	probably damaging	1.00
R9659:Vmn2r2	UTSW	3	64134521	missense	possibly damaging	0.79
R9666:Vmn2r2	UTSW	3	64116449	missense	probably benign	0.08
R9771:Vmn2r2	UTSW	3	64134658	missense	possibly damaging	0.88
R9788:Vmn2r2	UTSW	3	64134521	missense	possibly damaging	0.79
X0024:Vmn2r2	UTSW	3	64137286	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGGCTCTCACTACACTGTACGAA -3'
(R):5'- TCAGCTCTGCACTGGAGAGGAGAA -3'

Sequencing Primer
(F):5'- TGCATATTGCATATAGGGAACAGACC -3'
(R):5'- CACTGGAGAGGAGAAGCTGG -3'

Posted On

2013-04-24