Incidental Mutation 'R0357:Ift80'
ID 29859
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Name intraflagellar transport 80
Synonyms 4921524P20Rik, Wdr56
MMRRC Submission 038563-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 68799832-68911903 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 68821986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 686 (Y686*)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
AlphaFold Q8K057
Predicted Effect probably null
Transcript: ENSMUST00000029347
AA Change: Y686*
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: Y686*

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107812
AA Change: Y686*
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: Y686*

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152502
Predicted Effect probably null
Transcript: ENSMUST00000169064
AA Change: Y686*
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: Y686*

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217619
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 T C 5: 24,778,463 (GRCm39) K232E probably benign Het
AI837181 C T 19: 5,476,731 (GRCm39) T298I possibly damaging Het
Alox12 T C 11: 70,133,362 (GRCm39) Y614C probably damaging Het
Amn A T 12: 111,240,575 (GRCm39) probably null Het
Ankrd33b A G 15: 31,305,272 (GRCm39) S121P probably benign Het
Aox1 A G 1: 58,131,675 (GRCm39) Y1028C probably damaging Het
Asph C A 4: 9,453,314 (GRCm39) R736L probably benign Het
Atp2a3 G A 11: 72,861,757 (GRCm39) probably null Het
Cables2 T C 2: 179,904,025 (GRCm39) probably benign Het
Catsperg2 A T 7: 29,414,326 (GRCm39) Y360N possibly damaging Het
Cdh4 T C 2: 179,489,133 (GRCm39) S282P probably damaging Het
Col5a3 C T 9: 20,719,064 (GRCm39) probably benign Het
Ctso A T 3: 81,858,850 (GRCm39) probably benign Het
Cyp4f13 A T 17: 33,151,625 (GRCm39) Y125* probably null Het
Dapk1 T A 13: 60,877,372 (GRCm39) L537* probably null Het
Ddit4l G A 3: 137,331,946 (GRCm39) R104Q probably benign Het
Def6 C T 17: 28,442,909 (GRCm39) H322Y probably damaging Het
Dnaaf9 A T 2: 130,554,866 (GRCm39) probably benign Het
Dnah6 T C 6: 73,165,342 (GRCm39) N588D probably benign Het
Dzip1 T A 14: 119,146,950 (GRCm39) I320F probably damaging Het
Epb41l5 T C 1: 119,536,934 (GRCm39) H319R probably damaging Het
Erc2 A G 14: 27,498,979 (GRCm39) E285G probably damaging Het
Fat4 G A 3: 38,945,376 (GRCm39) G1423E probably damaging Het
Foxp2 C T 6: 15,409,839 (GRCm39) P480S probably damaging Het
Gadd45gip1 G A 8: 85,560,762 (GRCm39) A126T probably damaging Het
Gbp5 G A 3: 142,211,172 (GRCm39) D301N probably benign Het
Gm10360 T C 6: 70,401,297 (GRCm39) noncoding transcript Het
Gm6471 T A 7: 142,387,604 (GRCm39) noncoding transcript Het
Gm8674 T A 13: 50,056,149 (GRCm39) noncoding transcript Het
H2bc18 A C 3: 96,177,104 (GRCm39) K13Q probably null Het
Ift172 A G 5: 31,415,244 (GRCm39) S1322P possibly damaging Het
Insrr A C 3: 87,715,953 (GRCm39) probably null Het
Itprid1 T A 6: 55,945,019 (GRCm39) M580K probably benign Het
Krt87 C T 15: 101,384,900 (GRCm39) V399M probably benign Het
Macf1 T C 4: 123,351,776 (GRCm39) N3708S probably damaging Het
Matcap1 A T 8: 106,011,699 (GRCm39) V222E probably damaging Het
Mogat1 T C 1: 78,488,677 (GRCm39) S27P probably benign Het
Mrgpra4 A T 7: 47,631,574 (GRCm39) M9K probably benign Het
Mtus1 A T 8: 41,536,563 (GRCm39) S384R possibly damaging Het
Myo1a T A 10: 127,546,771 (GRCm39) M306K probably benign Het
Noxa1 G T 2: 24,975,862 (GRCm39) D403E probably damaging Het
Ogdhl T C 14: 32,068,415 (GRCm39) V884A possibly damaging Het
Or10ak12 A C 4: 118,666,614 (GRCm39) L149R probably damaging Het
Or2y1f A G 11: 49,184,613 (GRCm39) N155S probably damaging Het
Or6k4 T A 1: 173,964,865 (GRCm39) L185* probably null Het
Or6n1 T C 1: 173,916,675 (GRCm39) V23A possibly damaging Het
Paxip1 G A 5: 27,963,621 (GRCm39) probably benign Het
Paxx T A 2: 25,350,079 (GRCm39) E145D probably damaging Het
Pde4d T C 13: 110,087,802 (GRCm39) V560A possibly damaging Het
Pheta2 C T 15: 82,227,517 (GRCm39) A12V probably damaging Het
Plxnd1 C T 6: 115,946,421 (GRCm39) V847M probably benign Het
Polk T A 13: 96,641,105 (GRCm39) M151L probably damaging Het
Ptprq C T 10: 107,522,060 (GRCm39) probably benign Het
Pum2 A G 12: 8,771,785 (GRCm39) Q371R possibly damaging Het
Reln G A 5: 22,155,820 (GRCm39) A2224V probably damaging Het
Rmc1 T C 18: 12,312,266 (GRCm39) S169P possibly damaging Het
Scart1 T G 7: 139,807,808 (GRCm39) C660G probably damaging Het
Shroom1 A G 11: 53,356,035 (GRCm39) T362A probably damaging Het
Smarcd2 A G 11: 106,158,158 (GRCm39) probably null Het
Spg11 A C 2: 121,896,713 (GRCm39) probably benign Het
Tcaf3 T A 6: 42,566,761 (GRCm39) Y776F probably damaging Het
Thada A G 17: 84,538,364 (GRCm39) V1548A probably damaging Het
Trpv2 C T 11: 62,481,130 (GRCm39) P410S probably damaging Het
Ube2u G T 4: 100,338,851 (GRCm39) E39* probably null Het
Ulbp3 A T 10: 3,070,307 (GRCm39) noncoding transcript Het
Ulbp3 A G 10: 3,075,788 (GRCm39) noncoding transcript Het
Vmn2r2 C T 3: 64,041,320 (GRCm39) probably null Het
Vmn2r24 TCC TC 6: 123,792,369 (GRCm39) probably null Het
Wdr87-ps A T 7: 29,235,007 (GRCm39) noncoding transcript Het
Zfp110 A G 7: 12,570,302 (GRCm39) Y43C probably damaging Het
Zfp605 A G 5: 110,272,245 (GRCm39) T55A probably benign Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68,821,986 (GRCm39) nonsense probably null
IGL01020:Ift80 APN 3 68,871,012 (GRCm39) missense probably damaging 1.00
IGL01544:Ift80 APN 3 68,898,115 (GRCm39) missense probably benign 0.05
IGL01612:Ift80 APN 3 68,870,996 (GRCm39) missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68,869,629 (GRCm39) missense probably benign 0.00
IGL02187:Ift80 APN 3 68,892,789 (GRCm39) missense probably damaging 1.00
IGL02381:Ift80 APN 3 68,869,653 (GRCm39) splice site probably null
IGL02407:Ift80 APN 3 68,805,869 (GRCm39) missense probably benign
IGL02510:Ift80 APN 3 68,805,876 (GRCm39) missense probably benign 0.07
IGL02512:Ift80 APN 3 68,835,058 (GRCm39) critical splice donor site probably null
R0091:Ift80 UTSW 3 68,822,008 (GRCm39) missense probably damaging 1.00
R0212:Ift80 UTSW 3 68,847,506 (GRCm39) missense probably benign 0.05
R0348:Ift80 UTSW 3 68,843,232 (GRCm39) missense probably benign
R1381:Ift80 UTSW 3 68,822,116 (GRCm39) missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68,847,531 (GRCm39) missense probably damaging 1.00
R1643:Ift80 UTSW 3 68,823,490 (GRCm39) missense probably benign 0.06
R1899:Ift80 UTSW 3 68,825,846 (GRCm39) missense probably benign 0.00
R1926:Ift80 UTSW 3 68,823,498 (GRCm39) missense probably damaging 1.00
R2013:Ift80 UTSW 3 68,898,117 (GRCm39) missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68,825,332 (GRCm39) missense probably damaging 1.00
R4214:Ift80 UTSW 3 68,898,141 (GRCm39) missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68,871,023 (GRCm39) missense probably damaging 0.96
R4303:Ift80 UTSW 3 68,801,507 (GRCm39) missense probably benign 0.15
R4361:Ift80 UTSW 3 68,870,982 (GRCm39) missense probably damaging 1.00
R4576:Ift80 UTSW 3 68,857,863 (GRCm39) missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68,898,092 (GRCm39) missense probably benign 0.01
R4652:Ift80 UTSW 3 68,822,273 (GRCm39) missense probably benign 0.32
R4654:Ift80 UTSW 3 68,825,870 (GRCm39) missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68,869,623 (GRCm39) missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68,898,092 (GRCm39) missense probably benign 0.01
R4885:Ift80 UTSW 3 68,857,829 (GRCm39) missense probably damaging 0.98
R5357:Ift80 UTSW 3 68,898,113 (GRCm39) missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68,875,196 (GRCm39) missense probably benign 0.00
R5589:Ift80 UTSW 3 68,838,233 (GRCm39) missense probably damaging 1.00
R5806:Ift80 UTSW 3 68,857,809 (GRCm39) missense probably benign 0.09
R6910:Ift80 UTSW 3 68,835,068 (GRCm39) missense probably benign 0.01
R6962:Ift80 UTSW 3 68,901,878 (GRCm39) start gained probably benign
R7157:Ift80 UTSW 3 68,898,277 (GRCm39) nonsense probably null
R7452:Ift80 UTSW 3 68,901,615 (GRCm39) splice site probably null
R7504:Ift80 UTSW 3 68,825,338 (GRCm39) missense probably damaging 0.99
R8077:Ift80 UTSW 3 68,823,478 (GRCm39) missense probably benign 0.01
R8435:Ift80 UTSW 3 68,892,787 (GRCm39) missense probably damaging 1.00
R8821:Ift80 UTSW 3 68,869,583 (GRCm39) missense probably damaging 0.98
R8831:Ift80 UTSW 3 68,869,583 (GRCm39) missense probably damaging 0.98
R8897:Ift80 UTSW 3 68,857,809 (GRCm39) missense probably benign
R9222:Ift80 UTSW 3 68,825,894 (GRCm39) missense possibly damaging 0.58
R9328:Ift80 UTSW 3 68,847,483 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGACTGACTGACTGACTGAGCC -3'
(R):5'- TTCCCTTAGGAGCAAAGCATGTGG -3'

Sequencing Primer
(F):5'- tgactgactgaGCCATCTTAAGC -3'
(R):5'- CCCACATACTCATGTTTAGTGGGA -3'
Posted On 2013-04-24