Mutagenetix > Incidental Mutation

Incidental Mutation 'R0357:Insrr'

29861

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

038563-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R0357 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

splice site (15578 bp from exon)

DNA Base Change (assembly)

A to C at 87808646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

AlphaFold

Q9WTL4

Predicted Effect

probably benign
Transcript: ENSMUST00000029711
AA Change: E549D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: E549D

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107582
AA Change: E549D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: E549D

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166771

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 89.3%

Validation Efficiency

99% (74/75)

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,179,209	S169P	possibly damaging	Het
4930402H24Rik	A	T	2: 130,712,946		probably benign	Het
4931428F04Rik	A	T	8: 105,285,067	V222E	probably damaging	Het
4932431P20Rik	A	T	7: 29,535,582		noncoding transcript	Het
9230019H11Rik	A	T	10: 3,120,307		noncoding transcript	Het
9230019H11Rik	A	G	10: 3,125,788		noncoding transcript	Het
Abcf2	T	C	5: 24,573,465	K232E	probably benign	Het
AI837181	C	T	19: 5,426,703	T298I	possibly damaging	Het
Alox12	T	C	11: 70,242,536	Y614C	probably damaging	Het
Amn	A	T	12: 111,274,141		probably null	Het
Ankrd33b	A	G	15: 31,305,126	S121P	probably benign	Het
Aox1	A	G	1: 58,092,516	Y1028C	probably damaging	Het
Asph	C	A	4: 9,453,314	R736L	probably benign	Het
Atp2a3	G	A	11: 72,970,931		probably null	Het
Cables2	T	C	2: 180,262,232		probably benign	Het
Catsperg2	A	T	7: 29,714,901	Y360N	possibly damaging	Het
Ccdc129	T	A	6: 55,968,034	M580K	probably benign	Het
Cd163l1	T	G	7: 140,227,895	C660G	probably damaging	Het
Cdh4	T	C	2: 179,847,340	S282P	probably damaging	Het
Col5a3	C	T	9: 20,807,768		probably benign	Het
Ctso	A	T	3: 81,951,543		probably benign	Het
Cyp4f13	A	T	17: 32,932,651	Y125*	probably null	Het
Dapk1	T	A	13: 60,729,558	L537*	probably null	Het
Ddit4l	G	A	3: 137,626,185	R104Q	probably benign	Het
Def6	C	T	17: 28,223,935	H322Y	probably damaging	Het
Dnah6	T	C	6: 73,188,359	N588D	probably benign	Het
Dzip1	T	A	14: 118,909,538	I320F	probably damaging	Het
Epb41l5	T	C	1: 119,609,204	H319R	probably damaging	Het
Erc2	A	G	14: 27,777,022	E285G	probably damaging	Het
Fam109b	C	T	15: 82,343,316	A12V	probably damaging	Het
Fat4	G	A	3: 38,891,227	G1423E	probably damaging	Het
Foxp2	C	T	6: 15,409,840	P480S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,133	A126T	probably damaging	Het
Gbp5	G	A	3: 142,505,411	D301N	probably benign	Het
Gm10360	T	C	6: 70,424,313		noncoding transcript	Het
Gm6471	T	A	7: 142,833,867		noncoding transcript	Het
Gm8674	T	A	13: 49,902,113		noncoding transcript	Het
Hist2h2bb	A	C	3: 96,269,788	K13Q	probably null	Het
Ift172	A	G	5: 31,257,900	S1322P	possibly damaging	Het
Ift80	A	T	3: 68,914,653	Y686*	probably null	Het
Krt83	C	T	15: 101,487,019	V399M	probably benign	Het
Macf1	T	C	4: 123,457,983	N3708S	probably damaging	Het
Mogat1	T	C	1: 78,512,040	S27P	probably benign	Het
Mrgpra4	A	T	7: 47,981,826	M9K	probably benign	Het
Mtus1	A	T	8: 41,083,526	S384R	possibly damaging	Het
Myo1a	T	A	10: 127,710,902	M306K	probably benign	Het
Noxa1	G	T	2: 25,085,850	D403E	probably damaging	Het
Ogdhl	T	C	14: 32,346,458	V884A	possibly damaging	Het
Olfr1335	A	C	4: 118,809,417	L149R	probably damaging	Het
Olfr1392	A	G	11: 49,293,786	N155S	probably damaging	Het
Olfr424	T	A	1: 174,137,299	L185*	probably null	Het
Olfr429	T	C	1: 174,089,109	V23A	possibly damaging	Het
Paxip1	G	A	5: 27,758,623		probably benign	Het
Paxx	T	A	2: 25,460,067	E145D	probably damaging	Het
Pde4d	T	C	13: 109,951,268	V560A	possibly damaging	Het
Plxnd1	C	T	6: 115,969,460	V847M	probably benign	Het
Polk	T	A	13: 96,504,597	M151L	probably damaging	Het
Ptprq	C	T	10: 107,686,199		probably benign	Het
Pum2	A	G	12: 8,721,785	Q371R	possibly damaging	Het
Reln	G	A	5: 21,950,822	A2224V	probably damaging	Het
Shroom1	A	G	11: 53,465,208	T362A	probably damaging	Het
Smarcd2	A	G	11: 106,267,332		probably null	Het
Spg11	A	C	2: 122,066,232		probably benign	Het
Tcaf3	T	A	6: 42,589,827	Y776F	probably damaging	Het
Thada	A	G	17: 84,230,936	V1548A	probably damaging	Het
Trpv2	C	T	11: 62,590,304	P410S	probably damaging	Het
Ube2u	G	T	4: 100,481,654	E39*	probably null	Het
Vmn2r2	C	T	3: 64,133,899		probably null	Het
Vmn2r24	TCC	TC	6: 123,815,410		probably null	Het
Zfp110	A	G	7: 12,836,375	Y43C	probably damaging	Het
Zfp605	A	G	5: 110,124,379	T55A	probably benign	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	splice site	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	splice site	probably null
R5685:Insrr	UTSW	3	87800496	splice site	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87814194	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87810442	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87800484	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87813584	missense	probably damaging	1.00
R8917:Insrr	UTSW	3	87810969	missense	probably benign	0.00
R8960:Insrr	UTSW	3	87813079	missense	probably damaging	1.00
R8989:Insrr	UTSW	3	87815357	missense	probably damaging	0.96
R9015:Insrr	UTSW	3	87813603	missense	probably damaging	1.00
R9202:Insrr	UTSW	3	87813120	missense	probably damaging	1.00
R9251:Insrr	UTSW	3	87810084	missense	probably benign	0.08
R9327:Insrr	UTSW	3	87814297	missense	probably damaging	1.00
R9646:Insrr	UTSW	3	87814498	missense	probably damaging	1.00
RF022:Insrr	UTSW	3	87804485	missense	possibly damaging	0.51
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91
Z1192:Insrr	UTSW	3	87802579	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCACGATCATAAGCCATACAGTG -3'
(R):5'- AGCAGGCAATGTTCGCAGGTAG -3'

Sequencing Primer
(F):5'- GTTATAAGAATCCTGAGTCAGGCTG -3'
(R):5'- CAATGTTCGCAGGTAGACAATG -3'

Posted On

2013-04-24