Incidental Mutation 'R0357:Hist2h2bb'
ID29862
Institutional Source Beutler Lab
Gene Symbol Hist2h2bb
Ensembl Gene ENSMUSG00000105827
Gene Namehistone cluster 2, H2bb
SynonymsH2b-616
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R0357 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96269752-96270132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 96269788 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 13 (K13Q)
Ref Sequence ENSEMBL: ENSMUSP00000135427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098843] [ENSMUST00000177113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051089
SMART Domains Protein: ENSMUSP00000059105
Gene: ENSMUSG00000050936

DomainStartEndE-ValueType
H2B 28 112 1.48e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098843
SMART Domains Protein: ENSMUSP00000096442
Gene: ENSMUSG00000074403

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177113
AA Change: K13Q

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135427
Gene: ENSMUSG00000105827
AA Change: K13Q

DomainStartEndE-ValueType
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193036
Meta Mutation Damage Score 0.1781 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-dependent histone that is a member of the histone H2B family. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Hist2h2bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Hist2h2bb APN 3 96269809 unclassified probably benign
R0882:Hist2h2bb UTSW 3 96269744 splice site probably null
R0976:Hist2h2bb UTSW 3 96270086 missense probably benign 0.19
R1473:Hist2h2bb UTSW 3 96270072 missense probably damaging 1.00
R1507:Hist2h2bb UTSW 3 96269873 missense probably damaging 1.00
R4503:Hist2h2bb UTSW 3 96269924 missense possibly damaging 0.84
R4751:Hist2h2bb UTSW 3 96269151 unclassified probably benign
R4808:Hist2h2bb UTSW 3 96270013 missense probably benign 0.00
R6118:Hist2h2bb UTSW 3 96269951 missense probably damaging 1.00
R6585:Hist2h2bb UTSW 3 96270097 missense probably benign 0.17
R7527:Hist2h2bb UTSW 3 96269870 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACGCTGACTCTGCTGTAAATCAACC -3'
(R):5'- TTGTAATGCGCCAGACGGGAAG -3'

Sequencing Primer
(F):5'- TCAACCAATAAAAATGGAATACCGTG -3'
(R):5'- GCGCTCGAAGATATCGTTCAC -3'
Posted On2013-04-24