Incidental Mutation 'R0357:Gbp5'
ID 29864
Institutional Source Beutler Lab
Gene Symbol Gbp5
Ensembl Gene ENSMUSG00000105504
Gene Name guanylate binding protein 5
Synonyms 5330409J06Rik, Gbp5a
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 142493978-142522344 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 142505411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 301 (D301N)
Ref Sequence ENSEMBL: ENSMUSP00000143336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090127] [ENSMUST00000196255] [ENSMUST00000197459]
AlphaFold Q8CFB4
Predicted Effect probably benign
Transcript: ENSMUST00000090127
AA Change: D301N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000087587
Gene: ENSMUSG00000105504
AA Change: D301N

DomainStartEndE-ValueType
Pfam:GBP 18 281 4e-113 PFAM
Pfam:GBP_C 283 575 6e-109 PFAM
low complexity region 579 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196255
AA Change: D301N

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143336
Gene: ENSMUSG00000105504
AA Change: D301N

DomainStartEndE-ValueType
Pfam:GBP 18 281 2.8e-113 PFAM
Pfam:GBP_C 283 556 5.5e-106 PFAM
internal_repeat_1 579 640 3.01e-21 PROSPERO
internal_repeat_1 647 708 3.01e-21 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000197459
AA Change: D189N
SMART Domains Protein: ENSMUSP00000142938
Gene: ENSMUSG00000105504
AA Change: D189N

DomainStartEndE-ValueType
Pfam:GBP 18 65 4.7e-16 PFAM
Pfam:GBP 63 169 4.8e-33 PFAM
Pfam:GBP_C 171 444 9.3e-104 PFAM
internal_repeat_1 467 528 5.89e-22 PROSPERO
internal_repeat_1 535 596 5.89e-22 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199578
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The encoded protein acts as an activator of NLRP3 inflammasome assembly and has a role in innate immunity and inflammation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Listeria infection and NLRP3 inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Gbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Gbp5 APN 3 142500594 missense probably damaging 1.00
IGL01625:Gbp5 APN 3 142503028 missense probably damaging 0.98
IGL02294:Gbp5 APN 3 142503827 missense probably damaging 1.00
PIT4362001:Gbp5 UTSW 3 142500710 missense probably damaging 1.00
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0014:Gbp5 UTSW 3 142506735 missense probably damaging 0.96
R0166:Gbp5 UTSW 3 142506919 critical splice donor site probably null
R0414:Gbp5 UTSW 3 142507913 critical splice acceptor site probably null
R0457:Gbp5 UTSW 3 142507757 missense probably damaging 1.00
R0959:Gbp5 UTSW 3 142503124 missense possibly damaging 0.47
R1520:Gbp5 UTSW 3 142508014 missense probably damaging 0.97
R2143:Gbp5 UTSW 3 142503832 missense probably damaging 1.00
R2369:Gbp5 UTSW 3 142500719 missense possibly damaging 0.54
R3155:Gbp5 UTSW 3 142503127 critical splice donor site probably null
R4602:Gbp5 UTSW 3 142503785 missense probably benign 0.06
R4770:Gbp5 UTSW 3 142508076 missense possibly damaging 0.75
R5096:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R5605:Gbp5 UTSW 3 142501276 missense probably damaging 1.00
R7066:Gbp5 UTSW 3 142507729 missense probably benign 0.00
R7234:Gbp5 UTSW 3 142521137 missense probably benign 0.00
R7237:Gbp5 UTSW 3 142507700 missense probably benign 0.41
R7258:Gbp5 UTSW 3 142506781 missense probably damaging 1.00
R7475:Gbp5 UTSW 3 142501361 missense probably damaging 1.00
R7521:Gbp5 UTSW 3 142500621 missense probably benign 0.06
R7627:Gbp5 UTSW 3 142500558 start codon destroyed probably null 1.00
R7788:Gbp5 UTSW 3 142503080 missense probably damaging 1.00
R8077:Gbp5 UTSW 3 142507739 missense probably benign 0.01
R8896:Gbp5 UTSW 3 142505547 missense probably damaging 0.99
R8951:Gbp5 UTSW 3 142500720 missense probably damaging 1.00
R9390:Gbp5 UTSW 3 142503022 missense probably benign 0.00
R9758:Gbp5 UTSW 3 142500605 missense probably benign
R9761:Gbp5 UTSW 3 142507757 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGGGCCATTTGAATATTGTCCAG -3'
(R):5'- GACCAAGCCCACATAAGTGACTGTC -3'

Sequencing Primer
(F):5'- GGCCATTTGAATATTGTCCAGAAGAC -3'
(R):5'- GAATGCTTCCTGAAGATTTCTATGGC -3'
Posted On 2013-04-24