Incidental Mutation 'R0357:Olfr1335'
ID 29867
Institutional Source Beutler Lab
Gene Symbol Olfr1335
Ensembl Gene ENSMUSG00000066061
Gene Name olfactory receptor 1335
Synonyms GA_x6K02T2QD9B-18723799-18724749, GA_x6K02T2QD9B-18726774-18727577, MOR259-12, MOR259-5, Olfr1334-ps1, Olfr1335
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118808797-118809944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 118809417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 149 (L149R)
Ref Sequence ENSEMBL: ENSMUSP00000151219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084313] [ENSMUST00000105035] [ENSMUST00000219094]
AlphaFold B2RVY8
Predicted Effect probably damaging
Transcript: ENSMUST00000084313
AA Change: L133R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081339
Gene: ENSMUSG00000066061
AA Change: L133R

DomainStartEndE-ValueType
Pfam:7tm_4 50 326 2.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 54 323 3.7e-8 PFAM
Pfam:7tm_1 60 309 2.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105035
AA Change: L133R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100652
Gene: ENSMUSG00000073768
AA Change: L133R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 307 6.4e-8 PFAM
Pfam:7tm_1 44 293 2.9e-31 PFAM
Pfam:7tm_4 142 286 6.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219094
AA Change: L149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5876 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Olfr1335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr1335 APN 4 118809456 missense probably damaging 0.98
IGL02481:Olfr1335 APN 4 118809499 missense probably benign 0.01
IGL02483:Olfr1335 APN 4 118809499 missense probably benign 0.01
R0058:Olfr1335 UTSW 4 118809480 missense probably benign
R0069:Olfr1335 UTSW 4 118809690 missense probably damaging 1.00
R1274:Olfr1335 UTSW 4 118809396 missense probably benign 0.01
R1432:Olfr1335 UTSW 4 118809238 missense probably benign 0.00
R2305:Olfr1335 UTSW 4 118808861 missense probably benign 0.35
R2368:Olfr1335 UTSW 4 118809822 missense probably benign
R3842:Olfr1335 UTSW 4 118809255 missense probably damaging 1.00
R3980:Olfr1335 UTSW 4 118809303 missense probably benign 0.22
R4722:Olfr1335 UTSW 4 118808949 missense probably damaging 0.99
R5074:Olfr1335 UTSW 4 118808860 missense possibly damaging 0.82
R5439:Olfr1335 UTSW 4 118809363 missense possibly damaging 0.95
R5930:Olfr1335 UTSW 4 118809378 missense probably benign 0.01
R6917:Olfr1335 UTSW 4 118809129 missense probably damaging 1.00
R7287:Olfr1335 UTSW 4 118809742 missense probably benign 0.01
R7525:Olfr1335 UTSW 4 118809494 missense probably damaging 0.99
R7717:Olfr1335 UTSW 4 118808933 missense probably damaging 0.99
R8293:Olfr1335 UTSW 4 118809742 missense probably benign 0.01
R8765:Olfr1335 UTSW 4 118808962 missense probably benign 0.05
R8877:Olfr1335 UTSW 4 118809285 missense probably damaging 0.98
R9165:Olfr1335 UTSW 4 118808998 nonsense probably null
R9689:Olfr1335 UTSW 4 118809802 missense probably benign
X0023:Olfr1335 UTSW 4 118809621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCCATGCAAGCCAAGCTACG -3'
(R):5'- GGCTTCTCCAGTGATTCCACAACC -3'

Sequencing Primer
(F):5'- AGCTACGCACTGAAGGAC -3'
(R):5'- GGATATGGGCTATGTCACCAC -3'
Posted On 2013-04-24