Mutagenetix > Incidental Mutation

Incidental Mutation 'R0357:Abcf2'

29870

Institutional Source

Beutler Lab

Gene Symbol

Abcf2

Ensembl Gene

ENSMUSG00000028953

Gene Name

ATP-binding cassette, sub-family F (GCN20), member 2

Synonyms

0710005O05Rik, Drr3

MMRRC Submission

038563-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.219) question?

Stock #

R0357 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24565345-24577467 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24573465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 232 (K232E)

Ref Sequence

ENSEMBL: ENSMUSP00000030795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030795]

AlphaFold

Q99LE6

Predicted Effect

probably benign
Transcript: ENSMUST00000030795
AA Change: K232E

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000030795
Gene: ENSMUSG00000028953
AA Change: K232E

Domain	Start	End	E-Value	Type
low complexity region	6	19	N/A	INTRINSIC
AAA	115	308	1.6e-6	SMART
AAA	427	595	6.32e-5	SMART

Meta Mutation Damage Score

0.1052

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 89.3%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,179,209	S169P	possibly damaging	Het
4930402H24Rik	A	T	2: 130,712,946		probably benign	Het
4931428F04Rik	A	T	8: 105,285,067	V222E	probably damaging	Het
4932431P20Rik	A	T	7: 29,535,582		noncoding transcript	Het
9230019H11Rik	A	T	10: 3,120,307		noncoding transcript	Het
9230019H11Rik	A	G	10: 3,125,788		noncoding transcript	Het
AI837181	C	T	19: 5,426,703	T298I	possibly damaging	Het
Alox12	T	C	11: 70,242,536	Y614C	probably damaging	Het
Amn	A	T	12: 111,274,141		probably null	Het
Ankrd33b	A	G	15: 31,305,126	S121P	probably benign	Het
Aox1	A	G	1: 58,092,516	Y1028C	probably damaging	Het
Asph	C	A	4: 9,453,314	R736L	probably benign	Het
Atp2a3	G	A	11: 72,970,931		probably null	Het
Cables2	T	C	2: 180,262,232		probably benign	Het
Catsperg2	A	T	7: 29,714,901	Y360N	possibly damaging	Het
Ccdc129	T	A	6: 55,968,034	M580K	probably benign	Het
Cd163l1	T	G	7: 140,227,895	C660G	probably damaging	Het
Cdh4	T	C	2: 179,847,340	S282P	probably damaging	Het
Col5a3	C	T	9: 20,807,768		probably benign	Het
Ctso	A	T	3: 81,951,543		probably benign	Het
Cyp4f13	A	T	17: 32,932,651	Y125*	probably null	Het
Dapk1	T	A	13: 60,729,558	L537*	probably null	Het
Ddit4l	G	A	3: 137,626,185	R104Q	probably benign	Het
Def6	C	T	17: 28,223,935	H322Y	probably damaging	Het
Dnah6	T	C	6: 73,188,359	N588D	probably benign	Het
Dzip1	T	A	14: 118,909,538	I320F	probably damaging	Het
Epb41l5	T	C	1: 119,609,204	H319R	probably damaging	Het
Erc2	A	G	14: 27,777,022	E285G	probably damaging	Het
Fam109b	C	T	15: 82,343,316	A12V	probably damaging	Het
Fat4	G	A	3: 38,891,227	G1423E	probably damaging	Het
Foxp2	C	T	6: 15,409,840	P480S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,133	A126T	probably damaging	Het
Gbp5	G	A	3: 142,505,411	D301N	probably benign	Het
Gm10360	T	C	6: 70,424,313		noncoding transcript	Het
Gm6471	T	A	7: 142,833,867		noncoding transcript	Het
Gm8674	T	A	13: 49,902,113		noncoding transcript	Het
Hist2h2bb	A	C	3: 96,269,788	K13Q	probably null	Het
Ift172	A	G	5: 31,257,900	S1322P	possibly damaging	Het
Ift80	A	T	3: 68,914,653	Y686*	probably null	Het
Insrr	A	C	3: 87,808,646		probably null	Het
Krt83	C	T	15: 101,487,019	V399M	probably benign	Het
Macf1	T	C	4: 123,457,983	N3708S	probably damaging	Het
Mogat1	T	C	1: 78,512,040	S27P	probably benign	Het
Mrgpra4	A	T	7: 47,981,826	M9K	probably benign	Het
Mtus1	A	T	8: 41,083,526	S384R	possibly damaging	Het
Myo1a	T	A	10: 127,710,902	M306K	probably benign	Het
Noxa1	G	T	2: 25,085,850	D403E	probably damaging	Het
Ogdhl	T	C	14: 32,346,458	V884A	possibly damaging	Het
Olfr1335	A	C	4: 118,809,417	L149R	probably damaging	Het
Olfr1392	A	G	11: 49,293,786	N155S	probably damaging	Het
Olfr424	T	A	1: 174,137,299	L185*	probably null	Het
Olfr429	T	C	1: 174,089,109	V23A	possibly damaging	Het
Paxip1	G	A	5: 27,758,623		probably benign	Het
Paxx	T	A	2: 25,460,067	E145D	probably damaging	Het
Pde4d	T	C	13: 109,951,268	V560A	possibly damaging	Het
Plxnd1	C	T	6: 115,969,460	V847M	probably benign	Het
Polk	T	A	13: 96,504,597	M151L	probably damaging	Het
Ptprq	C	T	10: 107,686,199		probably benign	Het
Pum2	A	G	12: 8,721,785	Q371R	possibly damaging	Het
Reln	G	A	5: 21,950,822	A2224V	probably damaging	Het
Shroom1	A	G	11: 53,465,208	T362A	probably damaging	Het
Smarcd2	A	G	11: 106,267,332		probably null	Het
Spg11	A	C	2: 122,066,232		probably benign	Het
Tcaf3	T	A	6: 42,589,827	Y776F	probably damaging	Het
Thada	A	G	17: 84,230,936	V1548A	probably damaging	Het
Trpv2	C	T	11: 62,590,304	P410S	probably damaging	Het
Ube2u	G	T	4: 100,481,654	E39*	probably null	Het
Vmn2r2	C	T	3: 64,133,899		probably null	Het
Vmn2r24	TCC	TC	6: 123,815,410		probably null	Het
Zfp110	A	G	7: 12,836,375	Y43C	probably damaging	Het
Zfp605	A	G	5: 110,124,379	T55A	probably benign	Het

Other mutations in Abcf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00579:Abcf2	APN	5	24568796	missense	possibly damaging	0.95
IGL02867:Abcf2	APN	5	24571151	missense	probably benign	0.03
IGL03325:Abcf2	APN	5	24574212	missense	probably damaging	1.00
IGL03329:Abcf2	APN	5	24571248	critical splice acceptor site	probably null
R0281:Abcf2	UTSW	5	24566564	missense	probably damaging	1.00
R0815:Abcf2	UTSW	5	24567270	missense	probably damaging	1.00
R0835:Abcf2	UTSW	5	24574253	missense	probably damaging	0.99
R1793:Abcf2	UTSW	5	24568776	missense	probably benign
R2321:Abcf2	UTSW	5	24567253	nonsense	probably null
R5006:Abcf2	UTSW	5	24576537	nonsense	probably null
R5765:Abcf2	UTSW	5	24573423	missense	probably damaging	0.99
R6317:Abcf2	UTSW	5	24569158	nonsense	probably null
R6684:Abcf2	UTSW	5	24569139	missense	probably damaging	1.00
R6906:Abcf2	UTSW	5	24568842	missense	possibly damaging	0.90
R6980:Abcf2	UTSW	5	24565972	missense	probably benign	0.01
R8266:Abcf2	UTSW	5	24576591	small insertion	probably benign
R8267:Abcf2	UTSW	5	24576591	small insertion	probably benign
R8290:Abcf2	UTSW	5	24576591	small insertion	probably benign
R8294:Abcf2	UTSW	5	24576591	small insertion	probably benign
R8295:Abcf2	UTSW	5	24576591	small insertion	probably benign
R8446:Abcf2	UTSW	5	24566643	nonsense	probably null
R9038:Abcf2	UTSW	5	24571193	missense	possibly damaging	0.70
R9061:Abcf2	UTSW	5	24573506	missense	possibly damaging	0.57
R9342:Abcf2	UTSW	5	24573477	missense	probably benign
R9478:Abcf2	UTSW	5	24565942	missense	possibly damaging	0.93
R9518:Abcf2	UTSW	5	24566562	missense	possibly damaging	0.75
R9667:Abcf2	UTSW	5	24574187	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTGCTCAGAGCACTACTGGAAC -3'
(R):5'- TGGGAAACGTGAAGTGCCCATC -3'

Sequencing Primer
(F):5'- AGCACTACTGGAACTGGCTC -3'
(R):5'- AAACACCCTTGCAGTGTGTG -3'

Posted On

2013-04-24